GenePrediction:GLEAN_574 Details

Name: GLEAN_574
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:696919..699194 (+ strand)
Length: 2276
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:696919..697094 (+ strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_97:697147..697440 (+ strand)
Length: 294
Type: CDS
Source: GLEAN
Position: GCSC_97:697493..697523 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_97:697585..697789 (+ strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_97:698158..698247 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_97:698311..699194 (+ strand)
Length: 884
>GLEAN_574 class=GenePrediction position=GCSC_97:696919..699194 (+ strand)
ATGGATTCTGCAGAACGGAGGGACTATCTTCTACAGAGAGGGCACCTTCCGTCAAACGCTGTCATCGAATTTATGGAGAA
CAGGGTGATGGTTGGTTCGGGAACGGCGCTGGTGTTTTCGGAGAGTAGCAGCGAGTTTGTCTCGGTGGACGAAATCAGGC
GAGAACAGGAAATCAGGTATGAATGAGTGCCAAAGACACGTTAAAAGCTTGACCAACAAAAAGTATAGTGCAGAGCTATG
GGCGCAAGCGAATGCCCAAAAAGCCCAGCTCTTTGATCTGCTCGAGCAAGTGAACAAGAAACTCGACAAGAAAAGCGGCA
AGATCAGCCCGGTACCTGGGAAGGACCTGCGAAAATGCGATTGGGACGAAGTTCTGCAGGAGATTCAAACAACGACACAG
CGATGGTCAAACGGGCCTAGGAGGGGTTCAAAGGTGGCACAGGTTATTTCGAGGCTGGGTAACAGCTCAGAGGCTTTCAA
TAGCTGGATCCAGCTCCTGCCAGCTGGCGACTACGGCTCGAGGTGAGCTTGCTCTCTCTTGTGGATTACCTTAAGCTAAT
GCGTTCTGCAAAAGTATATGCGGTGCCTTTACTCTTATCATAGGGGTAAGTGGAACCAGGACCTTTTGCAAAAAGTATCA
CGAGTCTCGGCTCTAAAATGTAAAAGGCAGCAGAACAATACAGCCATGTCGAAGAAGCCGTACTCGAGGGCCTGGCCAAG
ATCCCTGAGATCATTGACGGCGCAAAGCGATATGTGCAAATATACGCGCAACAGAAAAAAAACCGGCTGGAAAGAAGAAC
ATTCGACATTTACTTGGCCATTTTGAGAGCGCTTGTTCATATGCTTAAGTTCATCCTTGAAGGATCGCTCCGTGCGTGCG
CTGGTTTTTTAGTGCGATGGCAACAAGCCAATGCTGACACTTTTGTCTATAGGAAAAACCGGGCTTGCCATCTTACAGCA
GTCTTCCTATAAGAAGCAGCTCGTTAGCAGCATTGATGACATTCAAAGTCAGGCCAATCGCTTGAAAGAGGAAGCCACCC
AGTGCTCACTGATGCGGCAGAAGGAAACGAACGATACAGTGTTAGATATTCAAAGCACCCAAAACTTAGCAATCTTGATG
AGCATGGAACACAAACGAAAGTTGAACGCCATGTACGGTCTTTTGGAGAGCAGTTTGCTGAGTGAGGTCCCTGACGTGTA
TACTAGACACATTTGTACACTGGCTAATTATCTCAACAGACTACCGGATGTTGCTAGATGTCCAGAACGATGAGCTGAGT
GGCCTTCAAGGGAGAAAAATGCTCGGGGCCCCGAGGACGTCGACCAAGGGTATGTCACCCAGCCTGTGCATCGGCACGTG
TCACAATTGCTTGCCCAGCTAATGTGCCATAGGGCAGGTGAAGAAACTGCAGCGTCTATTGCGCTTTGACCCGAACGCGG
TCGCGAGCGATGTCGAGGCCTGTCTCCGCAGCGGCAACGCCCTCGACGAAAGGGGCCAGTCCAAGGCGGCCGCGTTGATC
CGTGCGGCCATGTTCCAGCGGTTCATGAGGGACGAGACCTCATCAGGCTCGCTTCTGGTCAACGGCAACGAGGACCAGGC
GTCTGTCGACGGCCCGTCGCCGCTGACGCTGGTGGCAGCCAAGCTAGTGACGATTGCCCAAGCTGTGGGAGACGGCGCCG
ATTCTGATGCTGCTGCTGATGCTGAAGCCAAAGCTGTCGCTCGTTCCGGGTCCACCTACGTGGTGTCCTACTTCTGCGAC
AGGCACGTGCCCTACGGCGGCGGTGACGCCTTTGCCCGCTCGCCCGAGGGCCTGATGGCCAGCCTGTCGGGCCAGCTGCT
GGAGCAGATGCGGCGTCGCCGACAGAAACGACGAGGCACGGCCGCCAGCGTCGACGTCGATCTCTCCTTTGTCAAAGCCG
ACACCTGGACCAAGATGCAGGCGGGGCGCTACGATCTCCGCAGGCTGAGTCAGCTGTTTATTAAGCTAACAGGGCAGCTA
GCGCCGTCAGACGTGCTGCTCTGTGTGCTCGATGAGGTGTCGCTCTACGACACGGGCACACTCCGGAGCGGCCTGCTCGA
CGTGCTGCGGCGACTGACATGCCTGGCCGGCTCAGCCGAAGGTGGCCCCTGCGTCAAGCTGCTGGCGACGTGTCGCGGCA
CAGCCGGCTCGGCCGGACAGTACTTTGCCAGCCGCAGCGGCAAGGTCTTGGAGCTCGACGGGGAGGGCGCTGAGATCGAG
GACTCGGCAGCCTGGGAGATTGCTCACATGAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62