GenePrediction:GLEAN_5750 Details

Name: GLEAN_5750
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1232030..1226317 (- strand)
Length: 5714
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1232030..1231844 (- strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_173:1231763..1228909 (- strand)
Length: 2855
Type: CDS
Source: GLEAN
Position: GCSC_173:1228821..1228215 (- strand)
Length: 607
Type: CDS
Source: GLEAN
Position: GCSC_173:1227584..1226317 (- strand)
Length: 1268
>GLEAN_5750 class=GenePrediction position=GCSC_173:1232030..1226317 (- strand)
ATGAGTGTGCGTCTCTTCTTCGACCCTGCAATCCTGCTCTGTTCTGCTGGTGCTGACAACCCGCAGCGTTCTCTCGCAAA
GGCAGCAAACTATGCCTTGCAGCTCGACGAGGCCCGCTGCGAGGGCAACTGGGATGCGGTGCCTGAATTTGTCCGCAAGG
TCAGAAAGCATGCGCCCGACCGCGTCTGTATGTGACTCCCTATTATTTCTCTCCTGCAGAGGCCACCCTGCTTGAGACCG
GTTGCTGACTATCCTCGTGGGAAACAGGCCTCACGCTGACCGCCGAAACCGAATATGCCATTGACAAGGCGACACACAAC
CTCCCCCTTGCTAGTCGATCTGACACCGCCCCCGCCCCTATTGGGAATCTGGACGCTGCCGTCCAGCTGCCGAAGCTGAT
TTCCGTCATCGAGCAAGAGAATGGACGTCTCCAGGACCGGTATCAGGCAAAGGTCTGCGTCGGATGGCTGCACTGGGTCA
TGGGCGAGTACGACCTGGCCTTTAGTCGGCTGCCCAGAAGCCTCGAGCAGGAACTGGGCCAGTCGGATACTCCAACGGAC
TGGACGCGGGTCTGCGCCCTCAGGGCCGCATATCTGCGCGCAAGCTGCCTCGCCCGCAACGGCAACCGAAAGGAGGCCCT
GGCCATCTTCGAGGAAGGTCTTGCCTGCCTCACGTCTGCGCACAGTGACCAGCAGGCTCGGAAGCAGCTGCGCCACTGGT
CGGAGCTGTTCTTGACCGAGTTCTGTATGCTCTTCAGCCACACGCTGGAGCAGGGCGAGGTTAGCCTGCAGGACCCCAAC
TGCCTCGTCAGCCTCCGATCGTGGGCCCGGTACTGGGACAGCGCCAAGGGTGCTCCCTTGCCGGGAGGACATGGCTTCCG
CGGCTCTGTCCCGCGCCGGAGGATATGGTTTGAGTACTATGCCGTTCTGTCTGCGCTAGTGGAGGACGACCTGCCGTACC
CAGCCGTACTGGCTCCCGGCGTCTCGGGCGATGCCCCCACTCGCTCTGCCCGCGACCAGCTGCGTGTTGAGCTAAAGAAG
ATCGAGGCGACGTATGAGGCTCTTCTTCTGGACGAGACGCCCTTTCCGCGTGCCGATGAGGAGCGGGAAGAGGTGGAAGA
GTTTGTCCGCCTCGTGATGCAGAACTGGTGCATCATGAAGAGCCGAGGCTGGCAGCCGCAGGACCTGGGACCGGGTGGAA
AGGAGGCGCTGAGCCGCGGAATACTCGAGATTCTCTACCGTGCGGCGACCAAGACGTACCACTCAACGGCGATCTTGAGG
CACTTGTCCAACGTCCATCTTTCCGTTGCCGAGTTTGACCTGGCCTTCAAGGCCTTTGACTCGTACCTGAGCCTCATCAA
GAAGGGCAAGGCCCGCGTTGCCAAGACCGGCCACGACGAGCCGAGCCTGGACGACGACGCCACCGTTCTTGAGGCCGTCT
CACACTGCATTATGGTCCTGTGTCGGTTTGGCGATCGGACTGCTGTTGAGAAGGCCCACGGCCTGAGCCTGGAGCTGGAG
CAGTGCCTGCACGAGCTCAGTCACGTTCTGGCGGAGCAAGCCGACGAAGCCCACCCACAGCCGCAGACAAACCTAGTCGC
CAGAACCAGCGGTAATGACATGCCCCCACGCGTCCTCGCGGCGTCCTGGCAGGCCGTTGGGCTTGCACACGCGCAGTGGG
CACGCATGACATTCGACCCGCGGATCCGCCCCGACATCCAGGCAAAGGCGGTGCGGTGCCTGCGGAAATCCATGTCGCCA
GAGTTTGGCAAGTCGGCTAACCTGCGGAGCGTGTTTTGCCTCGGCCTCTTGCTGGCCGAGCAGAGAGAGCTGAGCGCTGC
CATTGACGTGGTCAAGGGGGCTCTGCTTGCCAGCAAGACGCCGGATGCCGACCAGGACCGGCTCAACGGGGTCTTCTGGC
GAGAGCGCGCCATGATTCCGTTGTGGCACCTGCTATCGCTTCTGATGAGTGCTCGGCAGGACTACGTCATGGCGGCGCGG
GCGTGCGAAGGTGCCTTTGAGCAGTTCAAGGACCCGACGATCCTCTTTGGCAGCGAGACGCTATACCGCAGCGAGCACCT
GAACGAGGCGGAAGCCAACGGCGACGAGACGCGCACTGCTTCCACGCGGGGTGTTGTCGACGATATGGACGACTTTGAGA
AAGAGAAGATCCTGGAGGTCAAGATGACGCAGCTGGCGCTTGTCGAGGTGCTGGAGAGCCCCAAGGTGGCGGTGAATGCC
AGCTCGGAGCTGCTCAGTCTGTATACGCGGCTCTTTGGTCCGGTGCAGCTGACAGAGGCCAAGATGCAGCTCAAGACGGC
GGACATGCCCAGGAGCTCGGCAGGCACGCTGCGCAGCATCCGAGGCAGCCTGTTTGGGCGTAATGGCGAGCGGAATGGAC
GCCCAACCACAAAGCACTCGGGTACGGCAGCTGGGCACCCGCAGACGACAAGCGACAGCAGAGACGGCGGCAGACAGTCT
CATCGGTCGTCCAGCCGCAACGGGCAGCGACACCGAAGCCAGTCGGGGAAGCGGCACAGCATCCGCAAGGACCACAGCGG
CAGCCGTCGGCGGGCGGCAAGCAGCGGCGCCGTGTCGCACCAGTCGGATCTTGCAGACGGCGACGCCCTCTTCACGCCTG
TTGACGATGGCCGCGACGGCTCCGAGGTCTACCAGTTTTCGACCGGCAGACGGCGACTGTCGTCGTCGGGCGGCCCGCCC
GTTTCGATGAGCCGGCAGGCTTCGCAGATCGAGTCGATGGCCTATGCTGCCCGAACGCGCAACCAGGATGGGCAGGAGAC
AGGCCTGGGCGACATTGAGCCGTCGTCGTCCCTGATGCCCCCGATCGAGTTCTCCAAGGACTTTGAAGGGCGGCGCCGAA
ACACGATTCTCATCGAGGTCTGGCTGATGATAGCCGGCTTCTATCGGCGCGCCGATATGATCGACGACGCCAAGGGCGCG
GTGGCTGAGGCGCAGAAGCTGGTCGAGTCGCTTGGCCGGGACGGATCGAATGATGCGGTCGCTGGTAGCGGTACTGGTTC
CTGCAGCAGCATCTCGTCCAGAGATGCAGGCTGGGCCGGGAAGAAGAGCATTGACGAACTCTGGGCAGACGTCTGGACCG
AGGTACGTGACAGCCTTCTTTCCGTCTTATCTCCTTTCTATTGTTTGCTCTTATGATCACCATGTACAATGTACTGACTG
TGCCTCAAGATGGGCCAGCTGTCTCTGATCGGGGACTCGGCTTACGCTGCCCGTCTCGACTTCGAGTCCGCCCTGACGCA
CTTCCCCGACCACCCGGGTGCCATCATCGGGCTCTCCAACATTCTCCTCGACGTCTATAGTGAGAAGCTGCTCCCATTGC
CGGCCATCCCGAGACTGGAGCTCGCCGACGGCAGCATGTTCCCAAAGCGGATCTCCAACAGCAAACATGGAGAGGGCAAG
GAGGAGAACGGTCCAGCCTCGCTCCCTTCGCAGCCGCTGGGTCTGGTGGTCCGGCCAAAGTTTGACACGGATACGTCTGG
TGGTGCAAAGAAGTCCGCTTTCTGCGAGGGAGCCCACCAGGACGAAGAGCTCGCTCCGCCCTACCAGGTGACTTCTCTGC
CTCTGGTTGACCGTCTGGCTGCACGCGACCGTGCCTACGCCCTCCTGTCTGGTCTGACGAAGCTGGGAAGCGCGTGGAAC
AACGCAGAGGCATGGTTCGTGCTAGCCCGTGCACACGAAGAGAGCGGGCAGCTGGACAAGGCCAAGGAAGCTTTGTGGTG
GTGCGTGGAGCTGGAAGAGGCAGCAGCCGTGCGTCCGTGGAGCGGTGCTGCTACAGGTAATTACATTCTGTGAAGTTGGA
AAGGAGAAGGGAGCGAGCGAGCGAGCGTGTGTGATAGAGCTGGCTTGAAGGGGAAGACATTTTGGAGGAAATATAATACT
GGATATTGAATCAATAGTGGTGATAGTAGTGGTGGTGGGATACGATTAGTAATAATGAACGGCGTTCTACAGTCCATGGG
TGGTCTGTGCACACCTATCGGAAAGGAAATTCGCATCCCCAACGGAGCTCTTATGCAGAGCTCCGGCGCAAGCTAGCTCT
CGCTCCATCGTCTCCCGATTTCGCGCGATAATTCGACTATTTTTTCCCCTCGAGACCACCCAACCACGCCACCAGGACCG
GAGCAGACAGTCGGCCATTGAGCATTTCCACTGTCTCCGTAGTTGAGAGCAGCTGTCGAGAAGTGGCCCGTTTGTGGATT
TGGAAGAGAATCAATTCCGGATCTCCCCACTCCAAAGCACAAATGGCGAGTCTTGCGGCAGCAGGTCGTCTATCAGCCAG
GCTGGCCGGACGGAGCTTGATGCGACCAGCGCGAGGTGAGGCAGGATGCGGACGGGAGGAGGGGATGTGAGAGAGAGAAG
AGAGAGAGAGAGAGCAGGGACTGATCTGGCATACCTGCCTCAACAGGCTTCCGCACCAGTGCCCGCTATGCCGTGGCGCA
AAACTTTACGATGCCGGCGCTTTCGCCGACGATGACGGAGGGCAACATTGCGACATGGCAGGTCAAGGAGGGTGACCGGT
TTGCAGCCGGCGACGTGTTGCTGGAGATTGAGACCGACAAGGCATCGATGGACGTCGAGGCCCAGGAAGACGGCCAGGTC
TTCAAGATCCTGCAGCCAAACGGCACCAAGGGCATCAAGGTGGGCACCCGCATCGGCGTGCTGGCCGAGGCCGAGGACGA
CCTGGCCAGCCTAGAGCTGCCGCCGGACGAGTCGGTATCGGCCTCGGCGAGCAAGAGCGGGTCTTCAGCGTCCGCCTCAT
CCGCCTCATCCGCCTCTTCCGCCTCTTCCGCCTCTTCCGCATCGTCTGCCACCACGACCTCCCGGTCCACGTCCAACCCC
CCGCAGAAATACCCGCTTCTCCCGTCGGTCGAGCATCTGATCCGGGAGCACGGCCTCGACCAGGCCACCATCGTCAGCCA
GGCTACGCCCACCGGTCCCGGTGGCCGTCTGCTCAAGGGTGACGTGCTCGCCTTTATGGGCCAGATCCCGGCCTCCGCGC
CGGCCGACGTGGCTGCCCGCCAAAAGGCCCTGTCCCACCTCGATCTCAGCAACATCGTTCTGCGGCCGGCAGCGGTAGCG
GCACCGAAGCCAGCAGTCCCAGTTTCTGCAGCAGCCCCAGCAGCAGCAGCAGCAGCAGCCATCACCACCCCTCCTCCCCC
AGCCACCACGCTGGTCTCGCTTCCCGTGTCGCTGGCCGCCGTCGTCGAGGTCCAGGAGAAGATCCAGGCGTCGCTGGGCG
TATTCATGCCCGTGTCGACGTTTGTGGCGCGGGCTACCGACGTGGCCAACGACGCGCTGCCCCGTGCTGGCCCGGCTCCG
GCTCCGTCGGCCGCACAGCTCTTTGACGAGATTGTGGGCGTCGCCAGCAGCAGCAAGACGCCGAACCTCACCCGCGGCCA
CTACCGCCCTCAGGTCTCGGCGCTGCCGCCCGCCTCCGCCTCGACCAAGCCGAAGGCCAAGACGCCGGCTGTCGACGTGA
TCGACATCCTTACCGGCAGCAGCAAGGCAGCCCCGGCTCCCAGGAGCCGCCAGCTGCAGCCGCCGCCAGCCGTGTCGACC
GGGGCCAACTTCTTCGTCCTCAGCGTGCCGACGGCCGAGGAGAAGCGGGCAAAGGTTTTTCTGGAACGGCTCAAGGTGGT
GCTGGAAAACGAGCCCGGTCGGCTGGTGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62