GenePrediction:GLEAN_5751 Details

Name: GLEAN_5751
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1223010..1220252 (- strand)
Length: 2759
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1223010..1222950 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_173:1222776..1222667 (- strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_173:1222505..1222151 (- strand)
Length: 355
Type: CDS
Source: GLEAN
Position: GCSC_173:1221906..1221788 (- strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_173:1221717..1221350 (- strand)
Length: 368
Type: CDS
Source: GLEAN
Position: GCSC_173:1221260..1220252 (- strand)
Length: 1009
>GLEAN_5751 class=GenePrediction position=GCSC_173:1223010..1220252 (- strand)
ATGGCAGAGGCGGATACGAATTCGGCGACCGTAGACAGCACGTTACAAACGAGGGCGCTCAGTATGGGCCGTCTCCGAAC
AAAACCATCGGCACAGTAGAGGAGGAGACTGTTTTTGCTCCTACTGCAAGGATGCTGCAAGACGAAACTGGGCGTCTCTG
TGAGAATCCTGCTGTTCAATACTCTTCGCTCTTTATCCGTTTCGAAGCGCGCTGAACATGTGTTCTTATGTTAGTGTACA
TTGGGGATTCGGCGACACTGTCCTACCTCAACTTGTTTCGCCGCATGGTTGAGAGCATCAACGGCGTGTCCGATTTCACA
GGCGATACCTACAAGGAGAAAATCGTAGAGACGGTCATATCACTACCGCCAAATGCACAGCCTCCGTGCCAGCTAGCTGA
CCGAATGACAGCTGAGATACTGGTGAAATCGTATTTTGCAAATGTGATTGATACTAAGATCCATTTGTGACATGCTGTCT
GGTCCGTATGCTAACCTGTCTCCAGACCATCGGCCTGGTCGACATCTTCGATAAGCAAAGATTTCGCGAAGACTTCGACA
CGTGTTATTCGAACCCGCTTTCTGCCAACAACCACTTCCTTTGCCTGCTTTTTCTCACCTTCGCCATTGGTCTGGTGATG
GCAACGCCAGAGCCCGGGACGAGGGAAGAGGCCGTCATTCGCCACCTGCGCGGTGGGAATGCAGACGAGCAAGCCGAGCT
GTTCTTTCGAAGCGCCAAACGTCTCGGCGACCCGTTAAACGGCTTTGAGGACGCAGATTTCTGGTCCATCCAAGCCCTCT
CGCTGATGTCCGTCTACATGCTATCCGTATCTAAGCGGAATGCTGCATTTGCTTACCACGGTTGGTGTTTACTGCTTCGT
CATAGGACTGCTTCTTCCACAGGCCGAGCCTTACTAATGGAAACAAGGCATGGCTGTGAGGTTGGCCATTGCTCTTGGTC
TACATCGAAAGGAACCGATGGCGCCCTTTCAGAGCCGTGATATGAAAGTGCGTTGCAGCATGTGGAAAACACTGTATGTG
CTTGACCGGTTTATATCCGCATCGCTGGGACGTCCGACGGCCATAAACAATGACGAGTGTACAGAAGCAGCCCTACAAGA
CGACATTGAACATTGCATGCCGTCGGCCGCTGGCTTCACTGCTGCTTCGTTTTCAGCAGAGTCTCCAGAAGAGCAGGTGC
ATTCCCACGGAATGAACGCATCTGTACGCAGCAGCCACATCGTTGGCACTATCCTTCAAAGAAGTGTATTCAAAACAACG
AGTTTCCACCCAGGTCATCCGCGACATTCGACAGCAATGCGACTCGTGGACACAGAATCTGCCTGACTGCTTACGCTGGC
AACGCCTTAAGCAGCCTGCCCTGCACAACAACATCAACAGCGGATATCCCTCACACGCCCACAAACACGGGTTGGCTGTA
CTGCATGTCAACCTGCTACATTATCACTCTATCATCCTGCTCACACGGCCCTTCTTTCTCTTCCTGATACAGAAAGACCA
TCGAGGGCCCGTTCCGTCGCAGCCACGTGCACGCACAGAGAAGTTCTCGGAGGTCTGTGTGGCAGCCTCCTACCAGACGA
TTTCGATGGTCCAAAGTGCCCGTGAGGCGATGTGCCTCCCTCAAAGAAACCCCTTCGTGATGTAAGTTTCTGGCTCGCCA
TCTTCTCCGATACGTCGTCCTGATTCTCCGAAAGGTATTTTTTGTTCACTGCGGCTCTGCTCATAATGAGCAACGAATTT
GTGGTCCTATTCTACACGCCGAGCTACGGAGTGGCGATCAAGAAGGCGATCTCCATTATGGAATACTTCTCGACGAACGA
TCAGCAGGCTGCACGGCTCTTGTGGATCTTACGCGCCCTCCAAGATGTTGTCTTGAAGCAGGCGAATGACGGGGTTGCAG
CCACGGGAAGCATCAACCCGTCTCGGTATTCGTATCATATGGGGGTTGGCAACGACAGCGCAGAACCGTTTTGTAGCATT
CTTGCCAGAGCCTCAGTTTCTACCATGGACAACTCTGAAGCCGGTGGAAGCAGTCACTGGCAGGACAGGAGAGGCAGAAA
CAGCTCGGTTCCATGCCCTTGGTATAGTTTTCAGTCTCAAAGCCGGAGTCATCCGTTGCGGAACGAGTCTGTGGCGGCAT
ATGGGGTGGGGACAGGTGCTCCACGTAATACACAAGTGCTGACACCTAGTCAAGAGTCACATAGTGGTCCGACGGGGCAC
TTTGGAGCGACAACTGTTCAGCCTCTATCTTCAGAAGGGCATCCGCCAATACCTCTAGCCCCAAAGCCGCCGACATATCG
CCAGGGGCAGCAGCACCTGGATGGCAGCATATATGAACCGGTCGGCAGCGGTCCGACTGAGACGTTGGATACAGACACAG
ATGATCTCGACTTTGAGTGTCTCTACGACTGGTCTGGTGGCGAAGGGACGGAAGTTGAACGCGGGGGTAGTAGCACTGCG
GACACGGTTGTTGCAGCTGTCTCATCATTCTCTCCAGGAACGCCACAGCGTCTTGTCCTTGGCGCCAACTGCGAGTTTCC
AACTCCTCAGAGCACGGGAAGATTTGAGAGAGATGACGTGCCCAAGACCCCGCCGCATCCTCCACTTCAGCCCGTCTACT
CCGACTACACCATGCACGCGAGTATCTGTGCCGGAGGGTGGAATACGACAGGGCCTAGTGCCAGCGGAACGACGATGCCG
CACGATGTTTCATTGTACCGGACGACTGACACTGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62