GenePrediction:GLEAN_5752 Details

Name: GLEAN_5752
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1216469..1213828 (- strand)
Length: 2642
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1216469..1215190 (- strand)
Length: 1280
Type: CDS
Source: GLEAN
Position: GCSC_173:1215042..1214822 (- strand)
Length: 221
Type: CDS
Source: GLEAN
Position: GCSC_173:1214763..1214542 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_173:1214393..1213828 (- strand)
Length: 566
>GLEAN_5752 class=GenePrediction position=GCSC_173:1216469..1213828 (- strand)
ATGCTGCGACGGGTGGTAGTGACGGGAATGGGGGCAGTGACGCCACTGGGTGTGGGCGTGCGACCGACATGGCAGCGGCT
GGTGGCGGGCGAGTCAGGGATCGGCGACGTGGGCGACCGGGAGCCGACGGCGCAGTGGGCGCAGCTGCCGAGCACGCTGG
CGGGCGCAGTGCCGGAGGGGCCTGATGGTGTAGCGAAGAGTGTGTGGGCAGCATCAGACTGGCTGGCGGCGGCGGAGCAG
CGACGAACATCACGGTTTGCGCAGTTTGCAGTGGCAGCGGCCGAGATGGCGCTGGTGCAGGGGCGCTGGACGGGCGTCGA
GGCAGGACCGACAGGCGGCGAAACGACGGGTGTGTGTATCGGCAGCGGCATCGGCAACCTGTCAGACGTGTACGAGACGA
GCGTGGCGCTGGCGGGCGAGGGAGGCTACCGCCGCGTGTCGCCGCTGTTTGTGCCGCGGATTCTCATCAATATGGCGGCC
GGTCACGTGGCCATGCGACACGGCTTCCAGGGTCCCAACCATGCGGTCGCGACGGCCTGCACGACCGGTGCGCATGCCAT
CGGCGATGCTGCCCGCTTCATTGCCCTCGGCGATGCCGATGTCATGGTGGCCGGTGGCGCTGAAGCCTGCATCCATCCGC
TGACCCTGGCCGGCTTCGGCCGTGCTCGCTCGCTCAGCACGTCCTGCTGTCGGCCTTTTGACCGCGACCGCGACGGCTTT
GTCGTCGCCGAGGGCGCCGCCGTCCTGCTGCTCGAGGACCTCGATCATGCGCGCGCCCGCGGCGCTCCCATCTATGCCGA
GCTGCGCGGCTACGGCTGCTCCGGCGACGCTCACCACATGACTGCCCCCCGACCTGACGGCGCTGGCGCCCTGCGCGCCA
TGCGTCGCGCCCTCCAGACCGCCGGCCTTCGTCCTCGCGATGTCGACTATGTCAATGCTCACGCCACCGGCACTCGCATC
GGCGACGCCGCTGAGGCTGCCGCTATCGCCTCCCTCATGCGCCAGGACCACGTCCTCGACCTCGCTGCCGTCACCGTCAG
CAGCACCAAGGCCGCTGTCGGCCATCTACTCGGTGCTGCCGGCGCTCTCGAGGCCCTCTTCGCCGTCCTCGCCATCACCG
ACCGCCTCGTCCCTCCGACCGTCAATCTGCAACATCCCGACGTCGGTCCCGCCTTCAACTTCGTCCCCGGCCAGGCCCAG
GACAAACACGTTCGCGTCGCCCTCACCAACAGCTTTGGCTTCGGCGGCACCAATGCCTCCCTCGTCTTCTCGGCTGTCCC
GTAGCCATGGTCGGTTCGCTGGTTGGACCAATTCCCTCTGAAAGAAGCAGTCACGTGACCACCTACGCATTTATCCGCTT
CCCATTTTTCTTATCGCCAATCTCTTACCTTTTTTTGCGTGCAATTTTCCTTTCCATCACGACGTAGCCGTTTGAGCCAG
CAGCAGCCAGCGACCACCACAGCAACCGCAACCTGTTCCTGCCGGTCACGCAATGTCCTGTCCAGGCTGTCGGTCATCTG
CCGGCCTGCTCTCGCGCTGCGCTCGTCCGACCACGACGGCCGCAGCAGCAGCCGGCGCCAGACAGACACGCCTCCGGCCT
CTCCATCAGACACCACAGCCGTCGGCAGCAGCATCCACACAGGCGCCGGTACGACCACGGCTACGACGGGCCAGTCAGGC
TGTGGCCCACAATCTACACACGACAGCACCCAATGCGAGCATCACCGGCCGTCTGGGCGACATGGCGCGCCAGGCTATGC
GGAGAACCGTCGAGCCGTACGGCGCCTTTGGTGTGACGCGGCAGATCTACCAAAAGTGCTCGCGGCAGGCCGCCTACGAG
ATCCCCGAGGAGCTCCGACGTGACGATGCCGTGCCAACGACGGAGGACGGCGAAGAGATTGGCGTGGGAGGGGGGATGTG
GCACGATGGTGAGTGAGGGAGGTGTAATGGTGAGATGTGATGGTGGGGTGTGATAATAGAGGTGTGAGAGCGCAGAGGAA
CGTTTTAAGAGAGAGAGAGAGAGAGAGACGGAACAGAAGAGGAAAGAAAAAGAATTGAAATGCTGACTAATCACAGACTT
TGGCCTCATGCCCTCCTTCAGCTCCTGGTCCCAGGTGACGATGCTGCACATGTACCTCGTCGTCACACGGCTGCGCTGCT
TCGACAAGGAGACATACCAGCTTTGGCAGTCCATGATCACGGACCACTTTTTCCAGGAGGCCGAGGACCGCATGGACCGC
GTTCACCACATCAGCTCGCGCGGCCTGCGCCAGCGTCACCTGCAGGACCTCTTTATGACCTGGCGCGGCATCATCGTCGC
CTACGACGAGGGTCTCGTGCGCAGCGATGCCGTCCTGGCCTCGGCTCTGTGGCGCAACCTGTTCAAGGCCCGGCCCGACG
CCGACCTGCGCGCCCTCGCCGCCGTTGTCGCCTGGATGCGCCGCTCCTTTGCTCTGCTCGACCGCATGCCCGACGAAACT
CTGGTGCTACATGGCGGCAGCGGCATCTTCGCCTGGCCGCCGCCCACCGCACACCTGGCCGCCGTCGACGCGCCGGCCTC
GCGCGAGCTGGCCGCCCTGCTGGCTCAGGTCCTGCCAGCAGAGCCGGCCGTCGCAGAAGAAGAGCAGGCAGCGACGGCAT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62