GenePrediction:GLEAN_5756 Details

Name: GLEAN_5756
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1190653..1189486 (- strand)
Length: 1168
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1190653..1190471 (- strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_173:1190405..1190004 (- strand)
Length: 402
Type: CDS
Source: GLEAN
Position: GCSC_173:1189947..1189648 (- strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_173:1189578..1189486 (- strand)
Length: 93
>GLEAN_5756 class=GenePrediction position=GCSC_173:1190653..1189486 (- strand)
ATGGCCGATCAGCAACACGAGGTCGACCTCGACTCTATTATTGACCGACTGCTAGAGGTTCGCGGCAGCCGTCCGGGAAA
GCAGGTTCAACTGCTGGAAGGCGAAATCCGCTTTCTCTGCACCAAGGCTCGGGAGATTTTCATCTCTCAGCCCATTCTAC
TTGAGCTGGAGGCGCCAATCAAGGTTCGTACATGTTCTTCCGCGCCGCAACGCTCCGTATCGCTTTATACTAATTCTGGA
AACCCTAGATCTGTGGTGATATCCACGGTCAATATTACGACCTGCTGCGCCTCTTCGAATATGGTGGTTTCCCTCCCGAG
GCCAACTACCTGTTCCTGGGCGACTACGTCGACCGTGGCAAGCAGTCGCTTGAAACTATCTGCCTGCTACTTGCGTACAA
GATCAAGTACCCTGAAAACTTCTTCATCCTTCGCGGTAACCACGAGTGTGCTTCCATCAACCGCATCTACGGCTTCTATG
ATGAGTGCAAGCGCCGTTACAACATCAAGCTGTGGAAGACCTTTACCGATTGCTTCAACTGCCTGCCCATTGCTGCCATT
ATCGACGAGAAGATTTTCACCATGCACGGTGGCTTGAGTCCCGATCTCAACTCCATGGAGCAGATACGCCGCGTCATGCG
CCCAACTGATGTAAGATCTGTTTGCTCAGGATCGCCTCTCGGGTTCTCAGAACTAACATGACGTAGATTCCCGATTGTGG
CCTGCTCTGCGATCTTCTCTGGTCCGATCCTGACAAGGATATCACCGGATGGAGCGAAAATGACCGTGGTGTATCGTTTA
CATTTGGCCCGGATGTTGTGTCGAGGTTTTTGCAAAAGCACGACATGGACTTGATCTGCCGTGCTCACCAAGTCGTCGAG
GATGGCTATGAGTTCTTCTCCAAGCGCCAGCTGGTTACCCTATTCAGCGCCCCCAACTACTGTGGCGAGTTCGACAACGC
AGGCGCCATGATGAGCGTGGACGAAAGCTTGCTATGCTCATTCCAGGTACGCAAAAAGCACCCGTCCCGTATCATGTTCC
TGCTTTTGGGCATTTGCTAACGTTAGCCTCTACAGATCCTCAAGCCAGCTGAGAAGAAACAGAAGTACGTTCCAGGCCTA
GGAAGCAGAAGATCCTTTGCTCCACCCGGGAATAGCAAGAAACCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62