GenePrediction:GLEAN_5757 Details

Name: GLEAN_5757
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1184111..1180577 (- strand)
Length: 3535
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1184111..1184109 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_173:1183879..1180577 (- strand)
Length: 3303
>GLEAN_5757 class=GenePrediction position=GCSC_173:1184111..1180577 (- strand)
ATGGTATGTTTTTGAACAAGTCTTGGATTTCGACATGGTGACTTCTTCCCCCTCCATGGGTGCCTGGGCCTCTTCTTTGA
AGTCTCCCTACCGTGTGCTAAAAATACCACATCTCAACTGTGATGCCTGAACTCGTTTGAAATCGGTGCATGACGACATT
TCCATGTTTATCATTCAGTAGCAAGGAAACAAGGCTAACATCTAACCTCTTTTCTTTTTCCTTTCGTAACAGGCTCCGCC
GCCGCACCAGAAACCCGAAAATGTGTTGAAGCGGGCAAATGAGCTCATCGGTGTCAACCAGGCACCGGCGGCTCTGACCC
TGCTTCACGAGCACATCACTTCGAAGCGTTCTCGAAATGTGCCCATCGCCTCGCTCGAGCCGGTGATGGTCTTGCTCGTC
GAGCTGTCGGTAGAGCAGAAGAAGGGCAAGATTGCCAAGGACGCCCTGTACCAGTACAAGAACATTGCCCAGAACACCAA
CGTCGGCACCATCGAGCTGGTCCTGAAGGAGTTTATTGAGCGCGCTGTCGCCAAGGTCACGGACGCCCAGAAGAAGGCCG
ACGATGTGCAGTCCACGCTCGAAGCGTCCCAGGCCCAGGCCGGCACCAGCAGCATCGACGATCTCGAGGCTTCCGAGACC
CCGGAGTCCATCCTGCTCGCAACTGTGTCGGGCGAGGTGTCCCGCGACCGGACCGACCGTGCCATCGTCACGCCGTGGCT
GAAGTTCCTGTGGGAGGCGTACCGTACCGTTCTGGACATCCTCCGCAACAATGCCCGTCTCGAGCTGCTGTACCAGAGCA
CGGCCATGCAAGCGTTTGACTTCTGTCTCAAATACGCCCGCAAGACCGAGTTTCGCCGTCTCTGCGAGCTGCTGCGCAAC
CACGTGCAGACGGCTGCCAAGTACTCGACGCAGATGCACGCCATCAATCTCAGCGAGCCCGACACGCTGCAGCGCCACCT
CGAGACCCGTTTCCAGCAGCTCAACGTTGCCGTCGAGCTCGAGCTCTGGCAGGAGGCTTTCCGCAGCGTGGAAGACATCC
ACACGCTGCTGAGCCTGAGCAAGCGCCCGGCCAAGAACATCATGATGGCCAATTACTACGAGAAGCTCACTCGCATCTTC
CTCGTGGGCGAGAACTACCTCTTCCACGCTGCGGCCTGGTCGCGCTACTACAATCTTCTCCGCCAGTCTGCCTCTCTGTT
AGCTACCGGTCAGGGCAAGAAGTCCGACAACCCGTCGACCTCGGAAGCTGATCTCACCAAGGCTGCCTCCTTTGTGCTTC
TCTCGGCCCTTTCCATTCCCGTCATCAGCACCTCGCGTTCGCGCGGTGCTATGGTCGACTTTGACGAGGCGAAGAAGAAC
AAGAACTCGCGTCTGACACACCTGATCGGCATGAACCAGGCCCCTACGCGTGCCGGCCTGTTCCGTGATGCCCTGTCCAA
GGCACTGCTGCGTCGGGCCCGCCCAGAAATCCGGGACCTTTACAACATCCTCGAAGTGGACTTCCACCCGCTCTCGATTT
GCAAGAAGATCTCGCCGATTCTGGCAAAGATTGGCGAGGACGAGGAGATGAAGCGGTACATCCTGCCGCTGCAGCAGGTC
ATTCTGACGCGCCTGTTCCAGCAGCTCTCGCAGGTGTACGAGACGGTGGACCTCGACTTTGTTGAGAGCCTGGCACAGTT
CCCAGAGTCGTACCAGGTGACGCGTGCCACTGTCGAGAAGTTCATTATGAATGGCAACAAGAAGGGTGATCTCGCGATCC
GCATGAACCACGCGACAGGCGTGCTGAGCTTCGACACAGACATATTCTCGTCTGCCAAGGCCATCCACGGCGGTTCTGCG
GCAGGCTCGGCCGAGGCGGAGTCGAAGTCGGTGCAGCGGCTGCAGAGCACGCCATCGGAGATTGTGCGGTCACAGATCAG
CCGGCTGGCCAAATCTCTGTACACGACGTGCTACTACATCGACTCGTCCTTCAATGAGTCGCGCATCGAGGCGCGGCAGG
CTGTGCTGGCCCGCGCCAAGGCCGGGGCCGATCAGGAGCACGAGGATATTCTTGGACGGAAGGACATCATCCAGAAGCGC
AAGGAGCAGGTGTCGGAGCTGCAGGCGAAGCGCGAGAAGGAAAATGCCAAGATCAAGAAGCTGCGCGAGCAGGCCCTTCT
GGAGGCAGAGCAGCAGCGGCAGTTGCAGGAGCAGAAGGAGCGCGAGCTCAAGCGTCTGGAGCGCGAGCGCGAGCAGATCC
GCCAGACCGAGGTGGAGAACATGATCAAGGAGCTAAAGATCGGAATCAAGTCCAAGGACATTGACACAGAGAATCTGGCC
AGCCTGGACCCGCAGAAGCTACGTGCCATTAAGCTGGCACAGCTTGAGCGGGAGAAGAACGACATCAACGAGAAGCTGCG
GATCACGGGCAAGCGGATCGACCACATCGAGCGGGCGTACCGCAAGGAGGAGGTGAAGAAGCTGGCGGAGGACTACGCTG
AGCAGCAGAAGCGGGACCGGGCCGCGTACGATACGGTGAAGAAGGAGACGTTGATTGAGGCGAAGCGCAAGCACGAGGCG
AACGTGGAGCTGAAGCACCGGCTCAGCCGGCTGGTGTCGCACTTTGAGGAGTTCCGGGCGGAGATTGTGGACCGGCGCAG
CGACGAATTCGAGCGGCGCCACCGGGAGGCAGAGCGGGAGCTGGAGAAGCAGATCGCAGCACGCAAGAAGGAGTACCGCG
ATCGCAAGCTGCGCGAGAAGCGGCAACGGGAAGAGGAGGAGCGGCAGCTGCGCGAGGCCGAGGAGCGGGCAGCACGCGAG
AAGGAAGAGCAGAAGAGACAGGAGGAGGCGCGGAAAGAGGAGATGGCACGACTCAAGGCGCAGCGCGAATCCGAGCGGCA
GGAGATGGCCGAGAAGGCGGCACTGCAGGCGCGACGCGAAGAGGAGGCACTGGCAAGACGAAAGGCCGAGCGCGAGAAGC
AGAGCGCAGCACCTTTTCGGCGCGAGACGGCACCGGTCGAGGCTGCCCCTTCGTCGGAGCGGCGGCCAGTGCTCAATCTT
CCCGGAGGCAAGGGCTGGCGCGAGAGAGAAGCATCAAAGGCAACGACGGGCACTTCCGACGACAGTGCGACTCCTCCGGC
ATCCCGACTGCCTCCGCGCACGAGCACGCCGATGGAGCGGACGGATTCGAACGAGCGTCCGAGCGAGCGGTTCAGCGAAC
GCCCGAGCGAACGTTTCAGCGAGCGCCCGAGCGAGCGCCCGAGCGAGCGTTCGTCTGGGCCGCCGCGGATTCAGCTGGCT
GGTGGCAGCAAGCCGTCGTGGCGTGACCGCGAAGCCGCGAAGACGGGCGGTGGTGGTGCGGATGGCGCCGGTAAGGACAG
CCCACCGCCACGGTCTTTCTCCGGTCGTGGTCCTCCGTTGGCGCGGACAGGCTCGTCACGCGGCGATGTTGGTCGTGAGA
ACGGCCGCGACTCGCCGGCACTGCCCAAGGAGACACTCGCACCGTCTGGTGCACCGGGCAAATGGGTGCCGCGGTCTCGG
CGTGGTGCTGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62