GenePrediction:GLEAN_575 Details

Name: GLEAN_575
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:703563..709166 (+ strand)
Length: 5604
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:703563..703748 (+ strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_97:703837..704321 (+ strand)
Length: 485
Type: CDS
Source: GLEAN
Position: GCSC_97:704387..704783 (+ strand)
Length: 397
Type: CDS
Source: GLEAN
Position: GCSC_97:704855..704964 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_97:705589..705698 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_97:705754..705829 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_97:705946..708780 (+ strand)
Length: 2835
Type: CDS
Source: GLEAN
Position: GCSC_97:708842..709166 (+ strand)
Length: 325
>GLEAN_575 class=GenePrediction position=GCSC_97:703563..709166 (+ strand)
ATGGGAAGTATAGTCGCACCCGAGACCCAGTCCAGGTTTGCAGATCTCGAGCTGCTTCCCTACGACGAGGCCTACATTGT
CCAGAAGAGCTTCGTCGACGATCCATCGCCAGACAAGATCACCCTTGGCGCTGGCGTCTACCGGGACGAGAATGCCAAGC
CATGGACTCTCCCATCGGTGAAACTTGTATGTGGAGGAAAGGAAGAGACGAGTCAAGTCCACGACTGTGACCAGACAGGG
CAGTTCATGCTGACCATCGATACCGCCGAAATAGGCCCTGTCCCGCCTGCCGGACGTGCATGATTACCTCCCCAGCGAAG
GCTTCCCGCCTTTTGTCCAGGCCGCCCGCGAACTGCTCTTCGGGTCCCTGACTGCTGAGCTCTCTCCCCGGCTTGCCACG
ATCCAGACCATTGCCGGAACCGGTGCCTGTCATGTCGGCACCGAGCTGCTGATTCGCCTGCAGCGCAAGCCGACTGCCGT
CTGGATTGCCGACCCGACCTGGATCAACCACAGCCTGATATGGACCATCGCGGCCGACGATGTTGAGCAGAAGCGGTATC
CCTACTACGACGCAGCCAAGAGACAATTCGACTTCCAGGGCACCATTGCCGCCCTGCGCACCGCACAGTCCGGCGACGTG
GTCATCCTGCAGACCTGCTCGCAAAACCCGACCGGCAATGATCCATCGCAGGAGCAGTGGAAGGAGCTGGCCGATGTGGT
GCAAGAAAGGGGTCTCTTTCCCTTTTTTGACAACGCCTAGTATGCAGCATCTCTCTCTCTCTCTCTCTCCTCTCTTCTCC
TTTTCTCATCATTCACACCTCAAGCCAAGGCTTCGCCTCAGGAGACCCCGATGTCGACGCCTGGGCCATTCGCCACTTTG
CTAGCAGGCCCGGCATGGAACTCGGCGTAGCCCAGTCCTTTAGCAAGAACATGGGCCTCTACGGCGAACGCCTTGGCGCC
TTTCACCTGCTCCTGGCCGATCCGGCTATCCTACCGGCCGCCCAGGCCAACTTGGTCCGCGTCCTGCGTGGCTCCGTGTC
CTCCACTGTGTCCTTTGCTGCCCGCGCCGTCGCAGCCGTGCTGACCGAAGACGATCTGCGCACACAATGGCGCATAGATC
TGCGCACTATAACTGACCGCATACAGTCGATGCGCAAGGCGCTGCGGAGCGAGCTTGAGGTGCTGGGCACTCCTGGCACC
TGGGGTCATATCACTGATCAGGTGCGCCGCCTTTCTGCTACGAGCATCCGAGTGCCATGCTGTCTGTCCCCGCTAACACG
CCCTTCTGGTAGCTCGGTATGTTTTCATACACCGGCCTCACAAGGAAGCAGGTAGAAGTGATGGCAAGCAAATACCACAT
CTATATGCTCCCCAACGGTCGCATATCTGTTCCCGGATGTCAGTATCTCCCACTGCGCATCAAACACAACCACAACTGAC
TGGGATAGTGAACCCTTCAAACTTGAAAACGGTAGCGGCTGCTATGGATGACGTAGTGCGAAACGTCATCTAGCCAGTTT
TACCCTGTTGTCTGATTGGAGATCCTTCATATGCAAATTCAACTGCTACAACAACCCAAGTCGCGAAGACGTTCTTCTCT
ATTGTGAATACTAGGCCGATAAGAGAATGTGTGAAAATTATAGGAACATTTTTCGTACTCATAGATTCGAGTACACGAAA
CCGCATAGTGCTCCATCTATTTCGTAGCTGCAAATTGAAAGAATTATTGTCCTGTTGCAAGTGTGAGGCTGCCCGTGTAT
ACGAGTAGAGTATGACCTCACACTGTTGGGACTGTGCTGTCCACGGCAAGCTACGTAATATGCAGTGGGCCAGAAACCCC
TTTAGTCAGTCACGTTTTTCGCGTCATCTTCGCGTTCCTCGATGCTGGGTCGTTCCCCACCTTATGGTTGCCTTTCTAGC
TTAGGAATTAATACTGTACCAATCTATCTCTACCTCTTCAGAGTACAGTCCTTTGGACCTTTTCATGCAACTACACCTGA
TTGCCCGTCTTGATTTCACAACCCAGCTCCGAGATGGCACCTGATATCCGTTCCTTCTTCGGGCCCAAAGGCGGAGCTGC
AGCTCCAGCTAAAGCAGCACCTAAGGAAGACGTTCCTGCAAAGAAGGGCCGTAGCAGTGAGTCTCGCGGGTGTAATTGAC
TGTATTACCGGAAGATTCTAACGTCAGAAAGGCCGCAAAGTTCTGGAAGACAGCGACGAAGACGACATTGTCGAGTATGC
CAAGTGCCAAATCCGAGAAGTCGACCCGTCTAACAGGCAATAGGACCAAGAAGCCTTCCAAGGCCACACCGAAGAAAAAG
AAATCGTGAGCTCCAGCTGCAAATCTGTTTGGACTACAACCGGTTATGCTGACAAATCGGCAGAGAACCAGAGCAAGTCA
AAGGCGTCGAGGTGTCAGCAAACGAGTATTTCTCGTCGGAAAAGGCGAAGCCATCAAAGTCACGATCAAATGCAACGAAT
CCCGACCTGAAGAACGCCAGCAAGACTGATATTGAGATTCGGCTTAGTCCACGAAAGAAGGACCCGGAGCCTGCACGTCC
CAGCGCAGCCGCCTCTACGAAATCGACGCCGACCAAGAAGGGACGAGCAGTGGCGACAAAGAAGCGGACAACTACAGCAT
ACAAGTCGCACAACCTCGACGACGACGATGCCTTTGTTGACGATGACGAAGACGGCGGGGATGATATATTTGCGGCTGAT
ACCAAGAGTAGCAAACGCAAAAATGACGACTACGTTGAGGACGAAAGCGATGAGGACGACTTCATGCCAAATCCCAAGAG
GGTAGCTTCTCGAGCCAAGGCAGCCGCTGCCTCTGTCAAAATATCTGATGATGAGGAATCCGACGTGAAGCCAAAAGCCA
GAGCCGGCAGGGGAACGAAAGCAACCAATGACGTCAAGGGATCGACACGCGCGGCGACTGCCAAAGCTGGCCGCACATCG
TCGGTGGCTGGTAAAAAACGCAAGACACCGGAGCCCGAGGAGTCAGACTTGGATATCTTGCCCGTGCCAAAACCCCGAAA
GAAGCCTGCTACTGCCACCAAAGCACAAGCAGCGCCCATGAAGGACAAGACAGAGAATGGCCTGCCTTCGTCTGTACAGG
CGATTTTGGCTTCTATTCCCACGGTTCGGCCGCCAACACCGCCGCCAACGGATACAAAGGCCAAATTCAACTGGAGAAAG
GCGGCTGGTGGTGGTGGAAACTCGACCGCACCGCCAAACGCCGGCGCTGTAGAGCTGCCGGAAGGAGCACCAAACTGCCT
TGTGGGCCAGACATTTGTATTCACGGGCCTCCTGCAGACTATTAGCAGAGATGAAGGGCAAGCTCTGGTCAAGCGCTATG
GTGGCAAGGTGACCACGGCCCCGAGCAGGAACACCAGCTGGGTGGTACTTGGCGACGACGCGGGCCCAAGTAAGCTGGCC
AAGATCAGCCAGCTGAGCCTCCGCACCATTGATGAAAACGGCCTGTTCGAGCTGATCAAGCGGCTACCAGCCGGCGGTGG
GGACAGCAAAGAGGCCGAAAAGGCTCGGCAAAAACAGGAAAAGGACGAAGAAAAGATCAAAGAGGCAGCCGAAGAGATGG
AAAGGGAAGAGGAGGCCCGCCGACTTGAGGCCGAGAAGGCGCAAAAGGTTGCTGCCAAGGTTGCGGAAAAAGCAGCCTCA
GCCAGCGGGAAAGGTGGCAGCTCAAACGGCAAGGATGGAGCCTCACGCTCACAGGCAGCCCCAGCACGTGTACCAACGCC
GACGGCGCAGCAACTTTGGACCACCAAGTATGCACCGACTCAACTGAACCAGATCTGTGGAAACAAAGCACAGGTTGAGC
GGATTGCATCTTGGCTGAAAAACTGGCCCAAGGCGAAGAAGTACGACTTCATGACAAAGGGTGCTGACGGGCTGGGCGCC
TCTCGTGCCATTATCATCTCGGGACCTCCTGGCATAGGAAAGACGACAGCAGCACACCTAGCAGCTAACTTGGCAGATCA
CGACGTAATTGAGACGAACGCCAGTGATACCCGAAGTAAGAAGCTGGTCGAAAGCGGTATTGGAGATACCATGGACAACA
CGTCGCTGCTAGGGTTTTTTGCACCAGACGGCAAGAAAGTGGACACGACAAAGAAGAACGTGGTGCTCATCATGGACGAG
GTGGACGGCATGTCGGCTGGCGATCGTGGCGGCATCGGTGCGCTGGCCAAGTTCTGCAAGAAGACGGAGGTGCCGTTGAT
TCTCATCTGCAACGAACGGCGACTGCCAAAGATGCGGCCATTCGACCACGTCGCGTTTGACCTCAGATTCAACCGGCCGA
CGGTGGACCAGATTCGCTCGCGTGTCATGACGATCTGCCACCGTGAGGGACTGAAGCTGCCGCCAACGGTTGTGGATGCT
CTCATCGAGGGCACAAACAAGGACATCCGGCAGATCATCAACATGCTCTCGACGGCCAAGCTTGACCAGAGTACGATGAC
GTATGATCAGGGCAAGGCGATGACAAAGGCATGGGAAAAGCATGTTGTGCTCAAGCCGTGGGACATCTGTCAGAAGATGC
TGGGCGGCGGGCTCTTTGCGCCGGCCAGCAAGGCGACGCTCAATGACAAGATTGAGCTGTACTTTAACGACCACGAGTTC
AGCTACCTGATGATCCAGGAAAACTACCTGAACACCAAGCCGATGGCGCTGAGCAGCAGCAGAGGGAACTACACGAAGCG
CGAAGAGCGACTGAAGTACCTGGAGCTGGTGGACAACGCGGCGCAAAGCATCAGCGACGGCGATCTGGTCGACCGGATGA
TCCACGGGCCACAGCAGCAGTGGAGCCTGATGCCGACACATGCGGTGTTCAGTACGGTGCGGCCGGCCAGCTTTGTTTCG
GGCCAGTTGATGGGATCAAACTTTACGTCGTGGCTGGGCAACAACAGCAAGACGGGCAAGCTCAGCCGTTATGTGCGGGA
GATCCATTCACACATGCGCCTGAAGGCGTCTGGCGACCACAACGAGGTGCGGCAGCAATATCTGCCGGTGTTGTGGCACC
AGCTCATCAAGCGCATGGAGCTCGAGGGCAAGGAGGCGATTGACGAGGTGATTGAGCTGATGGACAGCTACTACCTGACG
CGGGAGGATGTGGACGCGATCAAGGAGCTGGGCCTTGGCCCCCAGTCAGAAGACACGGTCAAGATTGATACGCAGGCCAA
GTCGGCCTTTACGAGAACGTATGTGTAATATTGCAACCTGTCCTTTGCCTGTTGATGTTCTTTTAACTAACTGTGGCAGG
TACAACGGCATGCCACACCCGATCCCGTTCATGAAGGCTAGCAATGTGACGGTGACAGCGAAGAGATCGGCCCACGATGT
TCCAGATCTGGAGGAGGCCATTGAGGAGGAAGACGATGCCGACGTGGCCGAGCCGGTGGAGGTCGATGAGGATGAGCTTG
ATCTCAAGACGGACAAGTACATCAAGCAGCCCAAGGCCAAGGCGAAGCGAGCACCTAAGAAGGCTGCAGCCAAGAATGTG
GACGACGATGAGGAAGGCAGCGCAAAGGGCCGCGGGAAGGGGAAAACAGCCGCTGCAAAGAAGGGAAGCAAGGCAAAGAA
GTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62