GenePrediction:GLEAN_5761 Details

Name: GLEAN_5761
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1166458..1162941 (- strand)
Length: 3518
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1166458..1166411 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_173:1166198..1166056 (- strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_173:1165664..1165641 (- strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_173:1165567..1165435 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_173:1165379..1163552 (- strand)
Length: 1828
Type: CDS
Source: GLEAN
Position: GCSC_173:1163483..1163299 (- strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_173:1163225..1162941 (- strand)
Length: 285
>GLEAN_5761 class=GenePrediction position=GCSC_173:1166458..1162941 (- strand)
ATGGATCAACAACCTCCATTGCCGACCTCGCTTGGCGAGGTAGAATCAGTAAGTAGGCCAAGCCTTCTCACTATGGACAT
CAAGCCCGAGTATAGGCTACCCCCGAGGCTTGAGGAAGACCTGAGAAGAAAGCTTGAGGGAATCGACTTTGCTCTGTTCT
GACAACGGCTGCCGCCTTGCGCGCTTTGCTTCGTGTTATGTAGTTGATTTTGGCTCTTTACGATCCGCATACCCCACATA
CCACTATCTCAACGATTCAGGAAACCTTGCAACGCATCCAGAAATCCCCCGAGGGATGGCAGCTCGCCCAAGCCCTGCTG
GACCGGCCAATCAAATCCACAACGGACGACCAGGTCAAGTTCTTTGGAGCTCTGACCATCATTATCAAACTCAACACAGA
GAGGTGCGTTCTCAAACTGCTCGCTGTTATTTGTAGGAAATTTGGCCTAGAGCCCCCGTATCTGACCGTATGCCAGTTCC
AATCTAGCTGACGATGATGCTCGCGAGTTGCTGCAAAACCTTATTCGATGGCTGATTGACTCTGCCGGTAATGGAGCAGG
CATATTATCGACCCAAAAGCTTTGTCATGCCCTTGTGACTCTTTTTATTCACTTTGCATCTCTTTGGCCGAACGCTGTTC
GGCATCTGGTCCTGTGCCTGCGAACTGGCTCCAACATACCGCCTAATGACCTTAGTCATGTACCAAATATTTCGGAATTT
GCAAGCGGCCTAGACTGGCGCTTTCTGCGAGTGGCCCTATGGTTCATAAATACACTGGTGACTGATGTTGGTAGGACTGA
TATGCGGGTAGCTAAATTGTGAGTCTGGCCTTGATTGTGCACCTCGTAGAGGCCGAATCGCTCTGATGTCCTCAATTCTA
ACCGATCTCAGCTCAGCTGTTCACAGCCAGCTCCTACAAAATGCAGCCGACGTATCTGCGCTTTTGCACGCCGGTCTCAC
TTCGCAAATCTCAGAACCACACCGGACGTCTGACCTTCGACGAGAGAGTATAAAAAGTCTCCAGGTGAGTGAGTCGTGTG
TATGTAAGGCCATCACTGTCGTGTTAACATCATATCCAGTCGTGGGTGCTGTATGCCCAGCGGTTGCCACAGGGTGGTGA
AGTCCTCGTTGTACCTCTTCGTGCTTTGGTCGGTCCGGTGATCTCGTGTCTTGAGAATGAGGAGCTGTATGAGGCAGCTA
TCGAGCTTCTTATCGACATTCTTTCAAACTATTCTTCATTCTTTACCGGCGAGCACTATGAGGCCATTGTCTCTATCTTC
GAGAGCCCGTGGGGCGAACAGCGTCTTCACCAGCTCGTCGGAGGCGATTTCGACTTTGAACCCCTTCAATATGGTTTACT
TCTCCTTGCCTATGGCGACGCAAGAGTGCAGACTCTCTTGCAAAGTCCGGACGAGCGATCACAAAAAACATTGTCAGCGT
TGTGCTTGCTGTTAACGGCAGCGGGACATCCTGTAGCTGAGGATCTGATATTCGTTCCGGCTCTTGAGTTCTGGTCGACC
TTCATTGAGACGTTGATCGACACTATGTACTCTGACGAGGACGGGCACAAGCCCTGGCTCCAACCAGCTCTGTCATTTGT
CATGCAGGTTGTGAGCCATTGCTGGGAGAAGATACAATACCCGCCGATCAAGGCATTTATGAGCTGGGATGCGTCTGACA
GGGCCGGATTCAAGGATGCGAGAAAGGACGTTGCCGACTTGTTGCAAACAGTATTCGCTGTGGCTGGCCGCGACCTCTTG
ATGCATTTCTCAGATCTGCTCTTGAGGTCGATTTCAGAGAAGGCATGGTCGCACATAGAGGCAGCCGCTTTTTGCCTAGC
AGCGATGTCAGACTGCATCTCAGACGACAGCGGCTATGATGAGCTTCTCAGCAGAATCTTTTCGTCGCCATTGTTTAATC
TGCTAGAGCTTGGAGAATCTCAGCTGTCTGTTCGGCTACGCCAGACAGCCCTGACTCTAATCGAGCGCTACTCCGAGTAC
TTTGAGCGCCACTCGGACAATCTCCCGGCAGCATTGAATCTACTTTTTGAGGCAGTATCAACGGCGTCTCTCACGGCTCA
AGCGTCAAAGTCCATATCGACACTCTGCTCGTCATGCCGTGCACTTCTTACCCCCGAGGCTGGCGCATTTCTCCAACAAT
ATCAGCTGCTCCATGATAACCCGCAGCTGGATGCTCTCGCCGAAGAGAGAATTGTCAATGCAATAGCTGCTATCATTCAA
GCAACGACCGACGAGGAGACCAGACTCGGATTGTTTGAACAGCTGCTGACTTTTGTCGTTCGTGACGTCGAGCAGTGCCT
GCAGTTGAAGTCTGGTGATGGCAATTCTCTGGATGTTGAAAGCCCTCTTGTGGCTAAGGCGGCAAGGCAATTTCAGCAGC
AACAATCACAGGAAAACCAGACTGTGCCGTCTGTTGATGATGTTCTACTGCAGGCCGTGCTGATTTCACTGCGGTGCCTA
GCTGCTATGGCACGTGGCTTCCAGTCAACCACTGAGGCTGTGGATTTAGATGCCGATGATACAACAAACAGCCGAGAGGC
ATCTGCCTCAGGGAACTCTCGTCTGTTTAGCCTGCAGACAAACATCATGGCGATGATGGCTGCCGTACAGACCGCCTTTC
CCAGAAGTGGCGAGGTAGTGGAAGTGGTTTGCAGCATCCTCAAAGCGGGCTTCTCTGAGACAGAGTCTGGCCCGTTTGTC
TTCCCACCCGCGATGGTCACGGAGTTTCTTATACGGCAAAATTCGCAGACCCCATACATTGGTTCCATCGTCAATACGTC
GTACTCGTTTGTCAGTTCTCTGCACAAGAGTTCCGACCATGAGGCTATGCTGAAAAGCCTGGGGTCTTTGATTCCTTGGG
CAATTGGACTTTTGCAAATGCTTCCAGGTATTTTCAACTAAATCTTCCATTTTTGACCGGGCACTGTCGCTGGACTGGAC
TGACATAGCGACCAGAGCCCGATGTAGATACGGAGCTCACACAGAGGGGAATTGAGTTTATCGACCGTGTGCTTCGGAAG
AGTCCGGCCATTGTGTTGCAATTGCAGCCAACATCACTGTTAGAGTTCTTCTTCATGTTCACCCTGAAGGTCCTCGATAG
CCGTGAGCCCTTGCCAAAGGCGGCCTCCGCTGATTTCTGGGTAAGCAATAAAAATCTGTCGAGCAGAAATTTGATGTAAG
TAGCTGACGAATGCTCTTTTTGTCCTTGCACAGACATCGTTTATTACTCTGAAACCAGAGGATACAAACCTACAGGCCGC
TGTTGGAAATGCCCTAGAGCACCTGGGTCCATTGGTGGCACAGTCGTTGATGCAGAACATCGGCGGCAATGCATCTCGGA
GCGAGCTGGATAAACTTAGCGAGCCGCTTAAGAAGCTTGTTGTTCAGCACCCTCGGGCGTCGACGTGGCTCGAACAGGCA
TTGATGAGCCCCTCATTTCCTAGTGACCGCGTCACGGCTGCGGAAAAGGCATTTTTCTTGAAAAAGATCATCAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62