GenePrediction:GLEAN_5762 Details

Name: GLEAN_5762
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1155230..1154136 (- strand)
Length: 1095
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1155230..1155143 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_173:1155066..1155053 (- strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_173:1154983..1154930 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_173:1154852..1154136 (- strand)
Length: 717
>GLEAN_5762 class=GenePrediction position=GCSC_173:1155230..1154136 (- strand)
ATGGACCCCCACAATCCACCTGCGAACCAGGGACAGCAGCAGAATCGCCCACAGCCTGTTTATGACGTATCTCGCGGCGG
CCATTATGGTGAGCTCCAGCTTCAAAGTCTCGCATTGTTCGGCATCACGCGACCGGACTGCTAACCTGCATTGCATCTAC
ACAGGCGCCAGTGCGGCGGTTCGTCTTCCTCTTCTCGGACGACCCTGAACAGCTCTTTACGTGCTGGATTGCTAATACGC
GAGACAGCTTTCGCAGCAGGGCTACGCCCCGTCAGAGCTCTACACGGGCCCTTGGGCAAATGTGCGTCCCCCACCCGACA
CTCGCTACCGCGAGACTGTTCGATGCGAGACATGCACTAACCAGCCTGGCTGCTTCAGGTACACCAAGGACTCACAGGAT
CGTACAAGGACATCCTGACGACGTACTGGCAGCAGACGATCACCCACCTCGAGAGCGACAACCATGACTACAAGCTGCAC
CAGCTTCCCCTCGCGCGTATAAAGAAGGTTATGAAGGCCGACCCAGAGGTTAAGATGATCTCGGCCGAGGCACCAATCTT
GTTCGCCAAGGGCTGTGACATCTTCATCACTGAGCTCACGATGCGCGCATGGATACACGCTGAGGAGAACAAGCGCCGCA
CCCTGCAGCGGTCCGACATTGCGTCCGCCCTGGCCAAGTCCGACATGTTCGACTTCCTTATCGACATTGTTCCGCGCGAG
GAAGCCGCCAGCCATGCGAAGCGCGGACCAGGCAATGCACCCGGCACCGTTGCTGGACCCGGTGGCGGTCCTGGTAGCGC
AGATGCTGCCGCCGCAGCGGCAGCTGCAGCTGCAGCTGCAGCAGCACAGCAGGGAGTTCCGCCTGGAGCTTCGGCGGCCG
GCCATCCTCTGGCTGACTACTCTATGGCGTCGCAGAACCTCGGCGGCGAAGCCGACTATCGACAGGCACCGAATATGTAC
CCGGTGCAGGGCCAGCCGGGTGCAGCTCCCGGATACGGTCAGCCACAGGGGCCGATATATGGCGAAATGGACCCAAGCAT
CTACAGTGGCTACACGATGCAGCCTCAACAGGTCGGTGATACAGTTATCCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62