GenePrediction:GLEAN_5763 Details

Name: GLEAN_5763
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1149042..1146280 (- strand)
Length: 2763
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1149042..1148515 (- strand)
Length: 528
Type: CDS
Source: GLEAN
Position: GCSC_173:1148234..1147977 (- strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_173:1147920..1147363 (- strand)
Length: 558
Type: CDS
Source: GLEAN
Position: GCSC_173:1147298..1147177 (- strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_173:1147111..1147081 (- strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_173:1147014..1146997 (- strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_173:1146924..1146896 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_173:1146828..1146800 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_173:1146735..1146665 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_173:1146603..1146489 (- strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_173:1146422..1146280 (- strand)
Length: 143
>GLEAN_5763 class=GenePrediction position=GCSC_173:1149042..1146280 (- strand)
ATGTCTCAGTTCCGGGACCAAGGCTTCCAGCAGACGTCACCATCTTCGTATACGGGAGTTGGCATCGACGTTGGCAACAT
CGGAAGCACACCAAACTCACGTACGATCGGGTACTCGCCAGGATCCAACTCGGTAAAGTCCGCTTCGAAGCCGAACCAGA
CCCCTGACCGTGACGGATCTGATGGCCAGCACTCCATCTTTTCCCCGACGGTTCAAGGAAGCGGTGGTGGCTTCCGCACA
ACGGGAATCCCCGTTGACAGAGACCCTTTTGTGACGCCATCTTCAAAAACGAAGACGCACGGCCAACGGCTGTCTGCCAC
AGCATCGTCATTTCGTCCATTTTATGACGAGCCGTCGGACGGGTCCGAAAGCAACCGATCTCGTGCCGGGGATGATTTTG
ACAACGAGCGTAATCAAGCCGCTGATAACATATCCCCGGCCCTCAGCACTGAACTGATGCTCTCCCGTTGCATTGAACTT
TCGGCCTCGACGTCTGTGACAAGCGCTGATGCTGAGGCCTATTTGGCGGTATGTGGTTTATTTTCTCATCTTCGTCACAA
GTCCGCTAAAACTCCCCAGAAACTGGCTTCACTTGGTTCCCCTTGCCAGGGACATAGGCAAATTTTCATCAAGAATTCTA
AGGCCTACATTCGGTTCACTAACATCAGGGATGCTTGCGTCACCCACCGCAATATCCATCTGTGTGGTCCTGAATGGATT
GCAAACTTCATGTCTCCTCCGAGTTTTGCACAGGTACACCCCGTTTTGTCCCTATCGCATGTTCTCCTAAGCTCACTGAA
CCTTGCAGATTATTGCACCGGGTGAAAACATAGCTGCAAATCACGAGGGACAGCTGGATCTACTTGCGGTTCTCCTCCAC
AATGCTCCTATGGGATTACCCCAGGTTGAGCCTGTTGTGTTCAAGCTACTTAGATCTGAGGGAGACCTCTTTGCATTCCG
GAAGCATCACCGCTCTGAGGATGGGGCCTTGAAGGCCGTCATCGAGTACTCGGACATCAACGTTGCACTCAATGTAGCGG
GAAAATTAAATGGAATCACAGTCGATGTATGTTTTCCTTTCGCTGTATACAACACTTTTGCGATAAAGTTAACCATTTGC
AGGGACTTCATCTTCGTATCGATTTCTACCAGGCAGAAGGTCATGCTGGCCGGGCAGTCCCACTCAACGAAGGAATTACA
ACGCCCATGCCGACCCCCATGCGCTATCCTCCAGATGAGAATATGGGGTTTCAAACCCAAGCTATGGGATCGTTTCACAA
ACCGCAACAGCCAGGGAACAATGGACTTCTTCCTGTTCGGCATCAGGTAACCCCCCCTGCTTCTGGTATGGGCGGCCCTC
CCCAAGTGGCACTGGTTCCCATGGTGCTTCGAAACCCATACACACCTGGTACGCCGCTTATTCTTGATCCATATGGTCCG
CATGGACACAATATGACACCAATGCCCGGTGGAACTCCTTTGGTTTTTCCCCCTGGCGCTCCAGTCTCCACGATCATGGG
ACATCATGGATACGACAGGTCTTCGACTGTGGCTAGTCGCTATAACAATCGTCGTGGTGGGGCGCTGCGCATAGACAGGA
ACCTGCACTACAACCCAAATGGTCATCACAACCAAGTTGATATCAACCGCATCCGGGAGGGTGTTGATGTTCGCACCACT
GTAGGCGGAGATCTATCCTTTCCGTTTAAAGCTCTGACATATTGAGATTCTGACATGTAGGAAGATCATGTTGCGCAACA
TTCCCAACAAGGTTGATCAACGGATGCTAAAGGCCATTGTTGACGAGTCCAGCTGGGGCAAGTACGATTTTATGTATTTG
CGAATTGATTTTGCCAATGACTGCAAGTGAGTTTTACCTTGAGGCAGATCCAGTAAAACTTGCAATGATGTGTATGCTAA
TGTCACTGAAGTGTGGGATACGCTTTCATCAATTTTGCAGACGTGAGTTGCTAGAGCCTCTGGTCTTTCAGACTTGATGT
ACGACTTTGCTAACATCTTACAATGCAGCCTTTGGATATTATCGACGTATGTTGTCTATGGACTCGAGAACCTCCCTGCA
CAGTTTGTGATCTCAAGTTGCTAAAAAAACAACGATAGTTTGCCAAAGCGCGCGACAATCAAAGATGGTTTGTTCCCCGC
TCACTTGCTTTCTTGGTGCAGGCTGCTCACATCTACTAGGAACTGTTTTCGCAGCGACAAGGTTGCCGAGATTTCTTATG
CTAGTATGTGTTGCTCTACTTTTATGCGGTGTTACCATGATGCTGACGGCGCCATTAGCGATTCAAGGTAGAGACTGCCT
GGTGCAGAAGTTTCGGAACAGCTCGGTCATGCTTGAGGCTCCTCACTACCGTCCTAAAGTATGCTGCCCACTTGTCGCTC
CTTAGTACTATACCGAAGACTAATATCTGACTTGAAAAGCTGTACTACACAGTTAATGGGACGAACCCCGACATGGCCGG
CCAAGAGGAAGAATTTCCTGGGCCAGACAATCCATCCAAGATGAAGCGAAGCTGTGAAAATGCAGAGCACGTTGGTGAGT
TGCATAACAGGGGCTTGGTTTTTCCGGACATAAAGCACGCATACAATGCTGACTGCCCAGGCCTCTTTACGCCACATCTC
AGTCAGTACTATCGCGACGAGCAACGCCGGCGGCGTTCTCAGTACGACCGGGGAACCAGAATGGCAGCTCTCGAGGAGTA
TGACTATGAGGCGACGCTTCAGCGGATGTATATGCCGCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62