GenePrediction:GLEAN_5764 Details

Name: GLEAN_5764
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1137684..1134072 (- strand)
Length: 3613
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1137684..1134836 (- strand)
Length: 2849
Type: CDS
Source: GLEAN
Position: GCSC_173:1134767..1134359 (- strand)
Length: 409
Type: CDS
Source: GLEAN
Position: GCSC_173:1134296..1134072 (- strand)
Length: 225
>GLEAN_5764 class=GenePrediction position=GCSC_173:1137684..1134072 (- strand)
ATGGCCTCATCCAGGCATGCGGAGAGGGGCGGCCGGACGGTGCCTTCGTTTGTGGCTTCGGCCGAAGCCCGCGATGATGA
GAGGGAGCGGCGGCGGTCTCAGTCTAGACGCGAGGACCGGCACCACCATCACCATCACCGTCACCACCACAGATCGCGTG
ATGAGCGAGACTTTCCGGGACGGCGTCCCAGTCATCGGGAGGACCGCAAGGAGAAGAGCAGTAGTGGCCGACGAGAGAGA
GGCCGCGAGACTCGGCATAGTCGCCCCGAGGGCCATGAAGGCCGAGCCAAAGGAGAGAGCAGCAGAGATGCAGACAGCAC
GCTCTTCACGGCCGATACGCGCGGCGACCCGCTGATCTGGCAATTTGGTGCCAACGACCGCAGACGAGTCCCCGTCTACT
CTCGGTTCCGCGAGGGACGCTCTGTTCTCGGCGCAGAGAGCCGGTTCCGGTTCAGCCACGAAGGTGCACAGGAGTTCTTC
TTTGTGGCGCCGCCAACGGATGGCGGCGTGCCCATTCTTCGCGACAAGAGCCACCCGCTGCTGGTCCGGGCTATGGCAGC
CAGTGCGGCCAAGGCGCCACGGCCGCCAGCAGGAGGCAGCGCTGATGTCGGCAGCTTTGGATCCGACTTTGTTCCCCTGC
GTGCTTCACGCAAGCGGAAGCGCAGCTCTGGCAGCACCGACAACGACAGCGATTCCGGCCAGTTGTCAGACTCGACGTCA
TCGTCATCCTCGGACATGGACGAAGAGGACGACGACGATGTCGACGATGGCGATGACGATTTTGTGGCGAGCGACGCGGC
ATCCGAGCAGCTGAAGCATCAGATGGTCGAGCTCTCGCGACGGGTCAAAGAGCAGCCCGGCGACGTGGACGCGTGGCTAG
AGCTCGTCGATCTGCAGGACCAGCAGCGTCGTCTGCTGGGCAACTCGGATCTCGCGCTAGGAGGCAGTCGCAGGGCGCCG
TCACAGGACGAGATAGCGGGCGTGGCCAAGGTTAAGCTGTCGATGCTGGAATCAGCCCTGAAAGGCACGACGGCGGTGGT
AGACCGGGAGCGCCTGCAGCTGGCAGCGATGCGCGAGAGGGCCAAGATGGACACGCCGAAACAGCTGGCCCAGCGATGGC
AGGACCTCGCGGCCGACAGTCCAGGTGGCGCCCTCGGATTTGCGCTGTGGAGGGCACGTCTCGACTTTGAGATGACCAGC
CTGTCGAGCTTCACCGTGGATGGGCTACGGGCCTTTCTCGAGGCCCGTCTGCGGCATATGGAGGATGAAGCAAAGGCAGT
AGCGGCAGCAGACGAAAAGAACAGCATGGATACGCAACTGGTCGAGATCTACGGACAGATGGTGTATGTGTTTTTGCGGG
CGACACGCTTCCTCTACGACGCCGGCTTCAGCAATCTGGCCACAGCCGCGTGGCAGGCGCTGCTAGAGAGCACGTTTGCG
CGGCCATCCGAGACAACTGCCGACACAGGTCTCGGGGCCTTTTGGGACAGCGAGGTGCGACGGATCGGCGAGGACGGTGC
CCAGGGCTGGCGATGCTTTGCAGCCGACGTGACAGCCGGCAAGGACGTCGACAGTCTATTGCCAGACGGTGATGGACAGG
TGCAGTTGCAGGTGCTGCCGACCATCGATCTGGACAGGATTGTCGACGGTGAAGACGCGGAAGAGCAGCTGTCAGTCTAC
AAGGCGTGGGTGACGGTCGAGAGGCAGCGGGCGGCGCTCTCAAGGCTGCCGGCGCGGCTGACCGACGACGTCGATGACGA
CGGCTACGACGACGTGTTCCGGACCATCGTGTTTGCGGACATGGAGAGCCTGCTATTTACCGTGCCGCTGAGGCTCACAC
AGTCCCTGCAGCCGCTGCTAGTCGACGCCTTCCTGGTCTTCTGCCAACTGCCGCCGGCCTTTGCGACGAGCAGCTGGATC
GAGGCCGCGCGCAACGACCCGTTCCTGGCCATTGTGTATCTGGGATCGGACAGACCGGATGCCGATCTGCTGACAGACGT
CGGCGGCCGCAGGCCACCAGATCTTGCCTGTGACGGCAGCCGTGTCGCCGTGTCGGCCGAGCTGCTCTTCGCACAGCCAG
AATGGTTCTGCTACCTGCCCGACTGGCTGCGGCAGCCCGATGGCGACAACAGAGCCCCCGTGCCGCCACGATGGGTGGCC
AACACGCTGCGACAGCTGGTGCGCTCGTTTGGCGTCGAGAACTTGGCCGCTTACAGCCTAGCGGTCGATGCAGCCGTGCA
GCCAGATCACGTGAAAAAGGCCGCACGGGCGCTTCTCAAGCAGTACCGCACAAACACGGCGCTGTACAACGCGTACGCCC
TGGCAGAACTGTCGCGCGGTCATGGCGATGTCGCCCGCTCCGTGCTGTCGCCGGCCGTGGCAGCCTCGGCCGCAGCAAGC
CCTCCGGACGTGGAGGCTGAGATGACACTACGGCAGACGTGGGCCTGGATGGAGCTCGAAGCCGGACACAAGAATGCAGC
CGTGCGCCGTCTTTTGCCAACAGACGCTGTCGAGGCTTCCGACGACAACGACATCCCCATTTCCCCGTCTCAGCTGCTCC
GGGCTCGCCGTGCCATGCACACAGAAATGGACTACGGGCTCTCTATGGGTCACATCGACCGGGCTACACTGTTTGCCGAG
TCGTCTGTGCTGCTCGAGTTTCTCTGCGCCACCGAAGACAGGCCTACGGCAGCCCGGTCGACGTCTCGCCAGGGAAACCT
GGCTGCCGCGCTGACGGCCTCTGCCGCCTTTTCCGACGAGATGCTGGCCCGTGGCCACGGCCAGACGGCCGCTCACGAGC
GCCTCTTGCAGTGGACGTCCCGCGTCCTGTATTTCCACGCGAGTCACGGGTACGAAAGACAAACCATTCCTTTTCCTTTC
ATTCCTTTCTATTTCCTGCCCTGCTGACCACGCTCAGACCATACCGGCCAGCCGAGCTGCAGGCGCCGCTGCGCCGCTTT
GTCGAGCTGTTTCCGCGCAACGGCCTCTTCCTGCGGCTGTTTGCCTGGATCGATCCAGCCTCGGCCTCGGGGCTGTCACG
GTTGCGGCCCGACGATCCGGTGCGACAGATCCTCGACACCGTCGTGCTGACGCGCGCGCACGACTGTCCCAGCAGCCGGG
CGTTTGCCGTTCGCTTCGCAGGCGGCACGTCCGGCGGCCGTGGTGATGCCCACGCTGTGCAGACAGCCTTTGCGCAGGCG
CTGGTCCCCCCTGACGGCACCCCGACGGCCTGCCAGGACAGCGCAGCCCTCTGGCAGGCATATGTGCACGTGACGGCTGT
GGCAGCGCTCACGGCACGTCGCAGCCGCGGCCGGCTCGACCGCAAGGTGGTGGCCCGGGCCAAAGACGTCTTTTACCGCG
CAGTCCGGGGCCCTGTCCCGGGGCCAAGGACGTGCTGCTGCAGGCGTTTGGACCCGCTACCGCACTCGTCGCCACGTCCG
CAGCCACGGCCGGCGCGGCCATGACGCCCGCCGAGCTGCGGGCCGTCTTCCATACGATCGTCACAGAGGGATTGCGCGTG
CACGTGGACCTGGGCCTCGTCCTGGAGCGGGCCGGTCAGATGGCAGAGCAGAGGAGGGCAGCCGCAGGCAGGGGCCGACA
AAACGACACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62