GenePrediction:GLEAN_5765 Details

Name: GLEAN_5765
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1124466..1119122 (- strand)
Length: 5345
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1124466..1124285 (- strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_173:1124111..1124009 (- strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_173:1123813..1121848 (- strand)
Length: 1966
Type: CDS
Source: GLEAN
Position: GCSC_173:1121298..1121077 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_173:1120878..1120754 (- strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_173:1120684..1119122 (- strand)
Length: 1563
>GLEAN_5765 class=GenePrediction position=GCSC_173:1124466..1119122 (- strand)
ATGGCCGCCAACCTAAACATTCCACAGCAGATGGGGATGCCACCACAGCAGCAGCGGAGGAATGGCATCCCCAGTCAGCT
CACGGCTATCGTGTACCAACAACTTGTGGCCAACACCCCCGTTGTCAGCGGGTGGCGAGCCGGGGTACAGTTTCCTGAGC
GTATGGGCAAGACTGTCAATTTGTGAGTTATCTGTATTCCTTTTTGTGGCCGCGCTTGTCTCCCTTTCTTCCTTTTTCTT
AATCAAAATCCTTCTTGCTTTTTCTATTTTTCTTGTACTGGTCCCGTTTCCCAACCATTGCTTGTCCACCCTTCCTTAAT
TCAACCGGCGGCCCGTACTCTTCTAACAAACATAGAATCACAAACATCATACTCGCAAACCCCGGCATCGATTGGCAAAA
GGCTGTGCAAGCGGGTCTCGATTTCGAGCGAAAGGCCTTTCTTGACATGCCGGACCGGGTACGTAGTCACTAATTGCTGT
CCAACCTTGCAAAATAAATCCTCCCAACATTCCTTCCTCTCCTCACTTAGTTCTCATTTCCCTTTGACTGGCACAAACAG
TCCTTCTTATACGGCGCTGCTTTGCGCTCTCTTCTTCTCTCAATCGCTTGCTCCCTTTCCCTGGTGTAGCCAAATTTAAC
AAACATGTCCCAGATTATGTACGATAAGCAAATGAACACCAAAATCAGCGAACAGTTTGTCAAACGACAGGTGAACGGAC
AAAATCTGCGAAATGACCTCAACAACCATCAAATTGCCCACGCCCAACAGCAAGCCCTTCAACAACAGGTAGCAGTTCAG
CAGCAGCAGCAACAACAACAACAACAGATGCTCATGGCCGCCCAGAATCCGATGCTGCAGGCACAGCTGCGTGCCTTTGG
ACAGAATCAAGGCTTCCAGCACATGCAACATCCTATGCAGGGCACGCCCATATCTCAACCACAACAAATGGGTGTACCAA
TGGCTCCCAATACCGGCGGCATGCAGATGGCACCCAATCAGCAGCCTATGCAAATGAATATGAATGCCATGAGGCCCAAT
GGCAACATGCAGCATATCGACCTGTCGAAGTTGTCTGATGCCGACCGCATGAAAGTCAACGAATTCGCCCAACGCCTATA
CATGAACACAGACGAAAACACTAAAAGGTCAATGCTCGCATCTGTACAGAGCCGCATGAGTCCTCAGACCATTCATAGCC
TACAGCGGCAGGGCAAAGACTTGGTCATGCACATGTTTCAGGTCCAGGCTCTGAACGTGCTGACAAACAAGGCACAGACC
ATGCGTGCGCAAATGCCTGGCCAGGACGTCAACCAAGCTCAGCAACGGATGCAGCTTCAGCAGAAAGCAATGGCATCGGG
TGTGATGAATCCCGGTATGATGAACGTCAGTGGTTCCGGACAGCCTGGTGGTCTTGGCGGTGGTCCGACAGGTCCAGCTG
CGGGGCAGAGCGGTCAGTACCCATTCTCCACCAACATGGAGACCATCATGAACGAGCAGAAGGCTGGTATGCTAGCTCAG
GAAGCTGGTCAGGTGGTTGTTCCTGCCAGCAGCGGCCAGCCCGGCCGTAATGCCACCCCTCAGCCTCAGGGCTCTGCGCC
CGGCGGTGCAGGTGGAGGAATGTCTGGCCAGAACCGACCCGGTGCACAGCAAGGCCAAAACCAAGGTCAGCATGGATCGC
AAATGCCGCAACAGTTCAACATGCCGATGGGCATGGATGCTGTCCAGGCAAATGCACAAAACCAGCAACGAGGAGGCGTA
GGGCCAAAGCAGATGCAGGCCCAGCAAGGTGCTGGCTTGGGCCATAGCCCTGGCATGGGCACAATGAGCACACCGATGGC
ACGCCAACCTACAGGCCAAGGTGACAGCTCGGCGCAACAGCACCAGCATCAGCAGCCACAGACACCCCAGCAACAGCAGC
AACAACTGGCACAGGGCGGACCGTACAACGGACAGATGGATCCCCGATTCGGTCAGCGCCCTTCTATGTCTGTGCCTGCA
AACCTCGGTCCTGCCTATCAGAACATGTTGAACAGTATGACCCCGGAACAAAGAGACAAACTCAGCTCCTTTCCACCGGA
TAAGTTGAACGAGCTGATGGCCAGATGGGTGCAAGGGCAACAGCAACAGCACAACCTTCGCACAGGGAAGCTTCCTACGG
CGACAGGGCAAGCCCAGCTGCAGACGAGTCGCCAGGGTCAGATGGGCACTGCACAGCCCAATAACCAGGCGGGCGGCGCA
CCCGGCCAGTTTGGTGTTGGCCAGCAAATGCCTGGCGTTCCGTCAAATATGGCTCTTCTGCAGCAGCAGCGACAAATGAT
GCGACCCCAAGCTATAGACAATATGGATCTCCCAACCCAGGTCACAAGTCGGTTCGCTCTTCCGCCAGATGTCAAGAAGT
GGTGCGACTTGAAGGCCTGGATAGCCCAAAATAACATCCCGGAAGGCGCCAAGAATCAGCTTCTCAATCTGCAGATGATG
CAATTCAGGCAGATCATGGATAAGAAAAACGCACTACAACAGGCGCAGCTAGCTCAACAGCGCACTATACCTACCGGTAT
GCCCGCCGGTGCTCCTGGAGCCCCCGCCATGAAGGCCGGAGTTGCAAACGGTGCCACAGGTATGCAACCGGTAGCAGGGA
TGATGCCCAACATTCCTGCGCACCTGTTACAGCTCACGCCGGCAGAGATAGCACAAATGCGTGCCACCAACCCCAAACTG
GCGAACGCGCCGGAAGAGGTGATCAAGAGATTTGGTTCTCGGATGAAACACGATAACTACATGAAGCAATATATGCAACA
GCAGATGAAGAACAACATGCCGCTCAATATGAATGGCATGCAGCAGCAACAACCACCTACTACACAGCCGTTCATGCCAC
AGCAGCAGCAGCCCCAGCCATCTAACCAGCAGCAGCAGCAGCAACTCCAACAGCAACAGCTACAGCAGCAGTTACAGCAG
CAGCTACAGCAGCAGCTTCAGATGCAACAGCAGCAGCAGCAACAACAGCAGCTACAGCTTCAGCTTCAAATGCAACATAA
TCTTCAGATGGACAATGCAAATGCTATTGCCGTAACGCAGTCCATGGGTAATACTCTCGCACAGCACAAGCCAATCAGTA
GCCCTATGCCTGCTCCGACTGGGAAGAGCGGCTCTTTGCCTCTTTCAGGGCCTCAAAGTGGTGGTCTGGACCAATCAGGT
GGCCCTTCCGGCGCTGTCGGTCCGAATGCAAAGAAGCTCCAAATGAACCGACAGGTCGTCAACAATCGAAAGCGCCCGAG
CTCTGACGAGGTGACAGACTCTGAACCGTCAAACGCACCGACTCAACGGTCTGTAGTAGCGGCTCCAAGTGTGCAGCAAC
AGCAACAACAGCTTCAGCAACAGCGCCTGAGTATGTTGCAACATATGACGGCGGAGCAATTTGCCAAATTAACACCAGAG
CAACAAGAGTTGGTTCGGTCTCGACAGCAAATGGTGGCTGCTTTCCAGCCCAATCAAGAAATCATGAACCACCTACTGGC
AATCGGTGCAGAAGTTCGGCAGGACATACAACAGGAACAATTTCCAGATATTCCTTTGACTGCGACAGAAAAGGACGAAG
TCTGGAAGAAGATCTTAGAGACGGCAGATCCATTGGTGAAGGTGGGCAAACAGCTCGGCCGTTTCTACATGGCAACACGG
GACGAGGTCCGAACGCACAGATTCTTTAGAACTGTAAATATTTGGCCCCTTCTCCCATGTCTTTTTGTCCTCTTTTCGCT
TATTTCATACTGACAAAAATAGCGGTACCGCATCTCTCAACAGTTCAGCAACCCCGAGACTCTGTCAGGACGCAGACCTA
ATTTTTCCATCACGGTGGACGAGATCGAATCGCATCGAAACCTGCTCATAGAGATGGGGAGAGAGGCTATGAACCATGTG
CGAAAAGCCCAGGCTTCTCTGGAGGCCCTGAACCAACACATCGGCCAAAAGATGTCACAAATGCCACAGTCCCAATCGCA
GATGCCGGGTATACCGCCGGCAGGACAGGCCGCAGATGTCAGCATTATCGGTGCATCATCGACTCAGACGGTTCCAGCTC
CTCTGAACCAAGCGAACCTTGAGGAGAACAACCGGGTGCTCAATAAGATGCAGAACCGGACAAACAGCAAGAGCGGAATG
CCTCCTGCTGCACCTACCACTGCTCAGCCTCCGTTCTCTCTCCATGCGACTTCTCCGCATGGACAGCCTGCTTACATTGG
CAAGCCAGCTGTGACCCAGGAGAACTTGCACCTACCTGCGTCGAAGAGACGGAAAACTGGTGGCCAGGCCACAGCAGCAT
CTCCCGCGACAACGCACACGCCTGCTGCGACAACACCTTCGCAGAAGGTACCGTCTCCCGATGCTCGAAGACATGGAGCA
GACGCGACCAAAGCACAGGCTCAGCCATCGATGACACCGCAACATCCCTCAAAGCCTCTCTTGTACTGCACGGAGGCTGA
CTGTGACACAAAGACAACTGGGTTTGCCACAGAAGAAGCGCGGCGTGTGCACATCGAAGAAGAGCATACGAAACCCAATG
CCAATCCTATGAAGTTTGTCACAGAAGCCCTGACAGATGCTTTCGGACTTGATGCCGACGGCAAAGCTAAAGGCGCCAGT
GCCTCTGCTGCTAATGGTGCTGCAGCTGCTTCCACCACCATGGCAGCGTTGGCACCCAGACAAGGCCCAGCTCCGGCGAC
ACCAATGTCCAGGGTTGCGTCTATGAACCGTCAAGCGAGTGCAGCAAGCGGCGTCGGTAAAGGGGCCAGCGGGGGTCTCG
CTGGGGGTATGTCGGGAAAGACCGGGTCAAGGGGAGATGCCTCTACTCTCAAGGTTTCAGATGGACAGCTTTCCACGGGC
GCAGAAGGCGATGCCCAGTTACCTATCCAGGTCGAGGACCCGTGGGATCTGGCAATGATTGACCCACATGAGCTTTCCAA
CGCTTTCAGTTTCACTGCTGATACCGTGGCAAACGGTGCAATCGCTGACTTCAGCATTTACCTGAACTCACTCACACCGA
ACGACACCCCCGAATCAAAGGCTGATAGTGGCTGGTCGTCGGAGCCGACAAGTGATATTTCGGAGAGCATTCAGGTCGAC
AATGGGCTGGATCTCTTCACCGCCGGCGATGGGACAATAATGCCTTCTATGCTGGACAGCATGCCACGGTATTCGATGCA
GCCGTCTGACGAGAACGATGCAGCAGACTTTGCGCAGATGTATCTGGGCGATGCGCCAGGCATATGTCCGCTCGATACGG
ACATGACCGAAATGTTCAGCAAGTCCAGCATCGAGCTGGATCCAGACCTGTACCAGTTCAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62