GenePrediction:GLEAN_5766 Details

Name: GLEAN_5766
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1117777..1116534 (- strand)
Length: 1244
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1117777..1117271 (- strand)
Length: 507
Type: CDS
Source: GLEAN
Position: GCSC_173:1117190..1116534 (- strand)
Length: 657
>GLEAN_5766 class=GenePrediction position=GCSC_173:1117777..1116534 (- strand)
ATGGCTTCTCCGGTCAAGAGACGCGCTCTGGCACCCCTCGACGCAAACACCACAGTTTCATCGCCACTTCCGGCCAAGAA
CGGCCTCGTTGGCAGCAAGCCCCTTCTACGGGGAGTTGAGGCCGCTCCTGGCTTGTCTATGCAGAGCGTATGTGAAGCGC
CACGGACGCATACATCTGCACCTGCGCCTGAGCAGCCAAGCTCGACAGCACAGAAGCGTTCTCTCCCGCCAGACGACCCT
GAAGACAAGGACCGACCCACCACTAGCACGCCGAAGAAGGTTTGCCTTGATGTGCATGTACCGGCTGGCGATGCTTGTTC
TGTTGGGTCCGTGTCTGAACCAGCATCGGCAAACCGTCGTCACTGCTCTATGTCCCCCTGTCCATCCTCTGTCTTCGACA
ATTCCGGCATTATCGAAATTTCCCAAACCACCAACGTTACAGAACCAAACGTCCAAGCGACACGGGCGACGGAACCACAC
ACGCCGACGCGGGAACAATCGAGACGGGTATGTCTTTTTGTGCTTCCCCACGGGCTGTGCCCCCTCTCATGCGTTGGCAC
ATTTCTTTGTTAACAAGCTACCCTTAGAGAGCCGAGATACTGAAGCTCCGGCTTGGCCTGGCAAGCTACAAGCTTCGTAC
TGGCCAAGTCAGCGTGCCCTTAGACCAGCTGCGTATCATGCAGCCTACTTCTCAGTTGGCCAGAAGTCAGAGTTTCAATA
GCCTTAATTCAAACAGCCGGGCTCAAAGCCGGCCTCGGATACTACTGCCGATGTCCCCGAAGCCAAAGCAGGCGACACGT
CGGAGTAATGAGCAGCCACAATCGCAGCTGCCACGGCGACAGTGGACCGCATGGGACCGGAGCCGGGGTCTGGCAAGAGG
TATGGGCGCGGTAGCCGCCTACAGCGACTCCAGCAGCGACGACGATGGGTTTTTCGACGACCACCACCGAGGAGCGAAAC
GTATGAACTTGGCAGCTGCCCCGCTTTTACGGAATCAGACGGGTAGCCATAACGAGTTTGACCGTATCGACAGGATCGAA
GACAGTGATGGCCAGCGAGAGCGTGAAGACAAAGACAATAATCGCTATAATGACACTAATACCAGTAACAAGAGCAAAGT
GGGAGTGGATGAAGACGTGCACAGAAAGATCAACGGCAGTCTGCCATCCCTGCCACAACCAATACAGCCTCGGGGTGTTC
TTAGTGGAGGTGCATCTGGTGGACTGCTTAGCATATCAAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62