GenePrediction:GLEAN_5767 Details

Name: GLEAN_5767
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1114115..1112121 (- strand)
Length: 1995
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1114115..1114105 (- strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_173:1114014..1113792 (- strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_173:1113719..1113235 (- strand)
Length: 485
Type: CDS
Source: GLEAN
Position: GCSC_173:1113172..1112801 (- strand)
Length: 372
Type: CDS
Source: GLEAN
Position: GCSC_173:1112727..1112121 (- strand)
Length: 607
>GLEAN_5767 class=GenePrediction position=GCSC_173:1114115..1112121 (- strand)
ATGGCTGCGATGTAGGTTTTGACATTTGCTTCATCCTGCGTTCTACTTTGGTGGCAAAGCAACGAACAAGCTGACCCGGT
ATCGCGTTTGCCTTTGCACAGTGAGAGCTTCGACAACATCTATCTAGATCTTTCCAAGGAGAACGGGAAATGCAGATTTG
CCGAAAATGGTCTAGGATGGAAGCCGGCAGGCGGCGGTGAAGCCTTCACGCTGGACCAGAGCAACATCAGCGGTGCGCAA
TGGAGCCGAGCTTCAAAGGGCTATGAGGTCAAAATACAGCAAAGGAGCTCGGGAATCATCCAGCTGGACGGATTCCAGCA
AGAAGTGCGCTTTATAATTCCAGTCGCACCCTGTGCGGCCCTTAAGGACAGAAACTAACGTCGTTTTTTTCAACAGGACT
ATGAGCGTCTCAGCAAGATCTTCAAGAATTGGTACAGCCATAACCTCGAGAACAAGGAGCACTCTGTGCGCGGGTGGAAT
TGGGGCAAGGCTGAATTCACCAAGGCCGAGCTCATTTTTAATGTGCAAAACCGCCCCGCCTTTGAGATCCCGTACTCCGA
AATATCCAACACGAATCTGGCAGGCCGGAACGAGATCTCCATCGATTTCTCTCTGAACGAAGACGCCAAGACGAACGGCA
AGGGTCCGATAAAGGGCAATAAGGCTGCCGCGGGGAAAGACCAGTTGATGGAGATGCGCTTCTACGTACCTGGCACGACA
ACGAAGAAGGAGGCCGACGGAGATGAGGCCGGTAGCGGTGCTGAGGAGGAGAAGAATGCGGTCACGCTCTTCTATGACAC
GCTCATGGAGAAGGCCGAAATTGGGGAGTCGGCTGGCGACACTATTGCCACCTTTTTGGATGTGCTACATCTGACACCAA
GGTACGTATGCCACAAGCTCTCCCCTGTTTGCGCCGTCGTGCTGATTCTTTACCTTATTCCAGAGGCCGGTTCGATATCG
ACATGTACGACTCATCTTTCCGGCTGCGTGGAAAGACGTACGACTACAAGATCCAGTATGACGCAATCAAGAAATTTATG
GTGCTCCCCAAGCCAGACGAGATGCATTTCATGCTTTGCATTGGCCTAGACCCTCCTCTGCGACAGGGCCAGACGCGGTA
TCCCTTTGTTGTCATGCAATTTAAGCGTGATGAAGAGGTGACGCTGGACCTTAACTTGTCGGAGGAGGAGCTGGAGAGCA
GATACAAAGACAAGCTGCAATCACACTACGAGCAGCCTCTGCACCAAGTCGTGACGTACATCTTCCGAGGCCTGGCCAAT
AAGAAGGTGACCACTCCTGCAAAGGACTTTACTACGTACGCTTTATATATCCCCTGCTTCTTTAGTTGCTCTGCAACGGC
CATATATTAACTGAAACCCCGTTTGCAGTCACCGGCAGCAGTTTGGCATCAAGTGCTCGATCAAAGCAAGCGAGGGATTC
CTGTACTGCCTGGAGAAGGCATTCATGTTTGTGCCAAAACCAGCTACATACATCTCGTATGAGCAAACACAGTCCGTCAC
CTTTTCACGGGTCGGTGGCGCTGTATCTACGCTCTCAACCTTTGACATCACGGTGCACCTAAAGAGCGGTGCAGGATCTT
CACAGTTTAGCAACATCAACCGAGAAGACCTCAAAGCCTTGGAAGATTTCTTCAAGCTGAAGGGTCTCCGCGTTAAGAAC
GAGATCGACGAGGATGCAAACTTGATGGCGGCTGCCCTGCGCGACCAGGATATTGATAGTTCTGACGACGAGCCCGGAGC
AGCCAAGGCGGACCGCGGATCTGCCGATGAGGATGAGGAGAGCGTTGACGAGGATTTCCAGGCCGAATCAGAGAGCGATG
TAGCCGAGGAATACGACTCGAATCACGAAAGCTCTGGTACTGGCAGCGATTCGGACGCCGAAAGTGATGTGGATAACGAA
GTGGATGACGAAGATAAAGAGCTGGACGGAGAGGAGGAGGAAGAGGAGCGGCCAAAGAAGAAGAAGCGGACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62