GenePrediction:GLEAN_5768 Details

Name: GLEAN_5768
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1111152..1107828 (- strand)
Length: 3325
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1111152..1111141 (- strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_173:1111059..1109502 (- strand)
Length: 1558
Type: CDS
Source: GLEAN
Position: GCSC_173:1109407..1107828 (- strand)
Length: 1580
>GLEAN_5768 class=GenePrediction position=GCSC_173:1111152..1107828 (- strand)
ATGGACAACCAGGTAAGCTTTCGATAGACGGCCGTCTTCTGCGGCAGTATCTCCTCTGTTCCTCCTCTTTCTAGTCTTCC
TAACGTCTTCTAGATCGAGAAGGCCATCGAGATCGCATGGAGCCCGACGTCCGACCAGGCGCTCAAAGGCCAGGCCTTTG
ACTACCTCCACCAGCTTCGCTCCGACTCCCAGGCGTGGCAAATCTGCGCTGCGCTCTTTACCCGATCACCGAGAACGTCA
GAGGTTGTCCGACTCGTGTCCCTGGAGATTGTCAATAATGCTGTGCAGACTCAAGCTTTCGATGGCAACAGCCTCTCTTT
CCTGAAGGACACGCTCCTCGAATACATCAGACGGACGTACGGCAGCGGCGATCCCGACCCTCAGGTCGATCCACCAGCCC
TGCAGAACAAGCTCACGCAGACGCTCACATATCTGTTTGTGTACTCGTACCAGGAAGGCTGGGAGACGTTCATCGACGAC
TTTCTCGCCCTGACCAGCTCACCCAACGGCAATGGAGGACGTGACAACGTCGCCGGCGTGGTGCTGTATCTGCGTATGCT
GGGCTCAGTGCATGATGAGATTGCCGACGTCATGCTGACGCGTCAGTCGGCCGATCTCAAGCGGAACAATAACCTCAAGG
ACCTGCTCCGGGACCGAGACATGCACAAGATTGCAAGGTCGTGGCAGGAACTGCTGGTGCAGTACAGCAACCAGAACGAC
CACATCCTTGAAATGACGCTCAAGATAATAGGAAAATGGGTCAGCTGGATAGACATATCCCTGGTTATTAACCAGGACAT
GCTCAGCCCTCTATTCTCGCTCATCGGACGTGTTAAACCCCATGGTGGCGACGACAAGGTGCGCGATGCCGCTGTCGACA
CCATCACAGAGATCGTGGCCAAGAAGATGAAGCCGGCAGACAAGGTCGACCTGATATCTTTCCTGAATGTGCGTGAGATC
GTGTCGCGGCTCGTGGCCTCGCCCGCACTTCATGAATTTCAAAAGACGCCCGAATACGACACCGACCTCGCCGAGGCTGT
GGCCAAGCTCGTCAACACTGTTGTGGCTGATATCGTGCGCGCACTGGACGACTCCAGCGTCCCGCCCGAGATCAGGGCGC
GTGCTGAACCACTCCTGCAGGAGTTTTCGCCGCTGTTGCTACGTTTCTTTTCGGACGAGTACGACGAAGTCTGCTCAACC
GTGATCCCTGCACTGACCGACCTCTTGACGTTTTTGCGCAAGATCCCCGATCTCCCGTCGGCCTACAGGGATATGCTGGC
GCCCATTCTCAATGCCATCGTCGGGAAGATGCGGTACGACGAGACGGCCAATTGGGGCAACAAGGAGGAGCAGACCGACG
AGGTGGAGTTCCAGGATCTTCGGAAATGGCTGCAGAACCTGCAGAAAAGCGTGGCTGCAGTCGACCAAGATCTCTACATC
GATGTGTTGAGCAATCTGATTGCCAGTGCTTTTCAAACACTCGACCAGATTGGCTCAAACATGGACTGGCGGGATCTCGA
CCTTGCTCTGCATGAGCTTGACCTTTTTGGCGAGCTGTCCATACCCAACCATGGTCTCTCCGCCAAAAGCAAGCCGTCAA
CTGCTGCCCAGTCCCGGATGGTGGCCCTGATGGGCAAGATGATGGAGTCCGGTAAGCCGACGTAGTTGGGTGATATGCAG
GTGGCACATGGCAGAGGAGAGCTGACAAGTATGTCCAGGTATTTCCGATTTTCCCCATCCTGCAGTTCTTTTGCAGTATA
TGGAGCTATGCAACCGCTACTGCAGTTTCTTCGAAAGCCACCAGGAATACATCCCGAGGGTACTAGAGACCTTTGTCCGG
CTGACACACCACGATCATCCACGCATACGAATCCGGTCATGGTATCTGTTCCATCGCGTTGTCAAGCAATTGAGGTCCCA
AGTCGGTAACGTGGCAGAGACGATCATCCAGTCCATCAGCGACCTATTGCCCATTCGGGCAGAAGTTCCCAACGACGATG
TGGACGACGACATGTCGTCAGACGAGTCCGACCACTCTGCGGACGCGCTGTTTAATGGACAGCTGTTCCTGTTCGAGGCC
ATTGGCTGTGTATCGTCGACAAGTGCGACGCCTGCCGAGAAGCAGGGTCTCTACGCGCGGTCGGTGATGGATCCGCTGTT
TGCGGACATGGAGCGGAATCTGCAGCGGGCCAAGGCGGGAGATGCTCAAGCCATCCTACAGATTCATCATATCGTCATGG
CTCTGGGTACACTGGCATATGGCTTCTCCGACTATCAGGTGCCGCAAGGCAGTGGCAGTGGCGGCGGTAGTGGTGGCAGC
ACCGGGGGCAATCGGCCGGCACCGGACAAGGCCATTTCGGCCGAGTTCTCGCGGGCAGCCGAAGCGATCCTCATTGCGCT
CGGTGAGCTGAACGGAAATTCGGAGATCCGTGCGGCCTGCCGCTCGGCCTTCTCGCGCCTGCTGGGCGTGCTGGGTGCGG
CCGTGCTGCCGCAGCTTCCCCAGTGGATCGAAGGACTGCTGTCGCAGACGTCGTCGATGGACGAAATGGCCTTTTTCTTG
CGGCTGCTCGAGCAGGTCGTGTTCAACTTCAAGGCGGACATTTACAACGTGCTGAACATGCTGCTGACACCACTGCTACA
ACGAGTGCTTGGAGGGCTGTCCGAGCCCATCACGGGGACCGATGACGAGATCCAACTGGCAGAGCTACGACGCGAGTACC
TTACGTTTCTGCACATCATCCTGGTGAACCATCTCGAGGGCGTTCTGATCAGCGAGGACAACCAGGGCTTTTTCGAGACG
GTGATTAACTCAGTGACCGCACTGGCTCGCATCATCGGACACGGCAATCTGGTGGCCAGCCGGCTGGCTTTCAGCGTGCT
AGCCCGCATGACAGTCGTCTGGGGAGGGCCAGACGTGGTGACGATCGCGGCGTCGGCAGACAACAACACGAATGAGAACG
GCAGCAGCAATAGCAACAACCAGTCGGCCAACAACGGGACTGGTGGCTCGTCCTCGCCGTTGATTCCGGGTTTCGACAGC
TTCGTCATCGAGCGGTTCCATTCGGCCTGCTGGGACGTGCTGTTCGATCCGCAGTTTCGTCCCGGCAAAGACGCACAGTC
ACGACAGGTGCTCCACGAAATTGCCGGTTTGGAGCAGACCATCTACGCCAAGACCGGCGACGCGTTTGTCCAGCACCTGC
AGGCGACGCTGTTTCCACGACTGGGCGGAATGGAGGCTGGAGCCGAGTTTGTGCGCTCCATGACGACTGCGGTGGACCGA
CGGGCGTTTGCGGCATATCTCCAGACGCTGCGGAAGAGCGGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62