GenePrediction:GLEAN_5769 Details

Name: GLEAN_5769
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1103193..1101519 (- strand)
Length: 1675
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1103193..1102703 (- strand)
Length: 491
Type: CDS
Source: GLEAN
Position: GCSC_173:1102653..1101519 (- strand)
Length: 1135
>GLEAN_5769 class=GenePrediction position=GCSC_173:1103193..1101519 (- strand)
ATGACGCGCAATGACGGTGCTCTCGACGGCGGCTGGCTGTCTCTGACGACCTCGCCGACCGCACGATCCACGACCGTGCC
TGAAGTTGTTCCGGTTGCTGCTGCCAGGCGCTCGTCCAACAACAATTCTAGCTCGGGCTTAGGCTCAGGCTCAGGCTCAA
GCTCAGGCTCGGGCTCGGGCGTGAGCACTATTCGGCAGCGGCGCACCAGCGCCGGCGGACAGCCCCCGGCAGCTCGTCGC
CGGCGCAGCTCCAGCCTGTCCGACTACAGTCAGGAAGCCCGCGAACTGCTCGATCCCACGCCAGCCATGACAGCTGCCGA
TGCACTGCGCCAGCAGCGGCCAACGTCCGGCTGGGACTCGCTGCCCTTGGCTTTCGCTCTGCTGCCGGCAGTTGGCGGGC
TGCTCGTGCAGGGAGGTAGCGCCTTTGTGACTGACTTGATGCTGCTGGCACTTGGGGCTATCTTTCTGCACTGGAGCGTG
ACCCAGCCATGGTGAGTCTATGTCAGCGAGACTCGCATCCGCATTGTGCTGACGTCCTAGGGTGTGGTACCACTCTGCGC
GACAGGTTCGTGAAGACCAGCAGACAAGCGTGGACTATGCCGTCGACAGTGACGTGGACGTCGAGGGACACAACGACGGC
AGTGGTGTCGACGACAAGGACACTGCCCGATCGACGAGCCCAGGCACGCTCGAAGACGTGCCCGAAGAGGGAGAAGAGGG
CGAGGACGTAAAGAAGAAAAGGGAAGCGGCAGAGGAAGCGAAGAGCCAGGAACGCTCCCAACACGCTGAACGACAGCGAT
TTCGTGCCGGCCAGGAAGCAGCGCTGCGTGAGCTGCACCGCCATGAGGTGCTGGCGCTGCTATCGTGTTTCGTGGCGCCG
GTGCTCGGAGCTTGCCTGCTGCATGGCCTCCGCGGCCAGCTGACCCGGCCGTCCGAGGGCCTCATCTCCAGCTACAACCT
GACCATCTTCATTCTCGGCGCCGAGGTGCGGCCGCTGCGCCACCTCATCCAGCTCGTCCGCGCCCGCACTCTGCACCTGC
AGCGTGTCGTCAACGCCAACCCCTACCGCGAGGAGGAGGAGCGCTACCGCAAGCGCCGTGCCGAGGAGGAGAAGGCCCAG
AACGAGACGCTGGCCGGCGTCGTCCAGCGTCTGGCCGATCTCGAAGGCCACGTCCAGCCTGGCCTGGCCGGCCTGTCGTC
GAGGCCTTCGACCTCCTCAAGAAGAGAGCACGACCAGCTGTTGCTCGACCTGCGCGCCCAGCTGCAACCAGAGCTTGACA
TGCTGGCGCGTGCTCTACAACGCACTCACAAGCAGCAGACGCTTCTGGAGAGTCAGTTGGCCGAACTGCAACAGGCAACT
GACAAGCAGGTAGACGAGGCCGCGTCGCTGGCCCAGGCTTCAGGCCAGCAGAAACGAAACAACTGGCTGCGAAAGGCCGG
CTTTTGGCTGCTCAGCATTGTGAGTGCAGCCTTGAATACCGTCCTGTGGCCGTTCCGGACGGCCTTGGCGGCTGTGCTGT
ACGTTCCGCGTCGGGTAGTCGTTCTGCTGCTGTCAGTAAAGCCGCCGGCACAGATCCGCCGCGCCGACAAGATCAACGGA
GCCAGCAGCAAAAAGGCAAGGGGTGACGCCACATTTGATAAAGTTGTCAGCAGCAAGGGTATGAGCCGAAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62