GenePrediction:GLEAN_576 Details

Name: GLEAN_576
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:709580..711285 (+ strand)
Length: 1706
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:709580..709809 (+ strand)
Length: 230
Type: CDS
Source: GLEAN
Position: GCSC_97:709867..710236 (+ strand)
Length: 370
Type: CDS
Source: GLEAN
Position: GCSC_97:710302..710530 (+ strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_97:710714..711285 (+ strand)
Length: 572
>GLEAN_576 class=GenePrediction position=GCSC_97:709580..711285 (+ strand)
ATGAATGGTTTCGTAAAAAGGGGCAGCAGTCGTCGTTCTCTGTATGACGACATGGCGGGCCAAGACATGTCAGCGACGAC
AAAAGTGACCATGTCATTTATGAAGGCATACAAGGCGATGCGCGGCCCTCATGACGTTGAGCCCAGCCCTCTCTTTAGCT
GTTTGGCTCCAGCAGATGGCAACAGGGGAGACGATGGCCCGTTTCGGCTTGCGGGACGAGACGAAATCAAGTACGTCTCT
GAAGACAGCGTGTAATGTCACGACATACAGAGCTGACGACGAAGCAGGATGCTCAACGACGTCAACGAAAGGCTCCTCGG
CGACGACTTCGACACGAAGCCACTTTTCGCCGACGACGAAGCTCGGCAGACGGTCTTTTACTTTGACGAGCCGCACACGG
CCAACGTTTACTTTTCGACGAACAGTGTGCTGGGAAAGACGTTTACCGCTGTGGCCGACCATGTCCTCAACCAAGAGACG
CTGGATCTAGGTTGGACGGAGGCGAACGGCACAGATTATGCTGATGGTGCGAGCAGCTTTGTGTCGGATGACGACGGCGA
TGCGGTCGAGAGTCGGATCTCACCGGCCGAGTTCCGAGCCCTCGCCATCGGCTGCAAGCGTAACGACGTCGACAGCCTGC
GGATTCCTATTGCCACTGTGAGCAACTCTCTCTCCTCGGACGCGGTGCTTAACTGACGGGCTGACGGTGCGATGATGGAC
AGACGGCTTCGGTCCGGCCGCTGACACCGCAGGACAAGATCATCGACCACGCGCATGAGGCCGGCCGAATAGACGCCCGG
GTCTTTGGCGGGCGCCGGCAGTTTGACGGCGACGACGGCGACGAGCTCAGTCCGGCCTACCGAGTCGACCAGGGGCCAGC
GCGGTCGGTGCTGTGGTCGCCGGCGGGCGTGACGCCCGAGCGCGCCGGCCTATTCCTGTCGCTGACGGACGGTGGGTTCC
TGTACCGCCGGATGGCGCCACAACCGTGCCAGGAGCTACGTGCCCGACTGTTTGGGGGGGTTGGCAGCAGCAGCAGCAGC
GACAGCAGCAGCGACAGCGACAGCAGCAGCGACAGCATCACCCACAACCGGCTGACCACGTTTGGCCGGTCCGAGGTCGA
CGAGGCGGTGGCAGCACACGCCCGGATCGGTGGTGGTGGCAGTCGAGCTCTCCCCAACGACGTGGTGTCGGCGGCGGACG
TACGCAGCGCTCTGCGTGACGGCTGGCGTGCTCTCCGGGCCTGCGAGGCCGAGGAGGCGCAGCTGGCGGCGGCCAACGCG
CGAGCTGAGGCGGCAGCGACGGTGCAGGCGCGACAACTCACACGGATGGAACGGCAGCAGGAGCAGCGCCGGACGGCGGC
GCGAGAGGCGACAGTGGCGGTGCAGCGCCAGAAACAAAAGCAGGCGCGGCGACAGCGACGCATCGTGCACGACGTGGCGC
TGCAGCTGCGCGAGCTGCAGGCGGCCGTGCGGGCAGCAGAGGCGAGGTTGGCACGCGGACGCGAATGGCAGATCGTGCTC
GCACGACGGCTGCGCTCGGGGGAGAAACGGCTCCGGGCAGCCGGGATGCGAGGGAAAGAGGGGGGAGGAGAGATGGAAGA
GGGTGACGACGACGACGACGAATATGCAAGCGGCTACAGAGGATACGAAACGGAAGACGAGGACGAAGCGAAAGGACACA
AACAACAGCTGAGACGGAACAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62