GenePrediction:GLEAN_5770 Details

Name: GLEAN_5770
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1096749..1093184 (- strand)
Length: 3566
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1096749..1096389 (- strand)
Length: 361
Type: CDS
Source: GLEAN
Position: GCSC_173:1096322..1094464 (- strand)
Length: 1859
Type: CDS
Source: GLEAN
Position: GCSC_173:1094341..1093184 (- strand)
Length: 1158
>GLEAN_5770 class=GenePrediction position=GCSC_173:1096749..1093184 (- strand)
ATGTTACCGCGGCGGCACTGGCTTGTAGCTCTTTGCTCGCTACTCTATGTCGACCTCGCCTTAGCCGGTGTGATTAACCC
TCTTCTGCAACGGAGGGCCGAGCAAAGCACCACGGCTGCAGCTGCAAAAACAGAGGATGCTTCTTCTTCTGCTTCTCCTG
TAGCCACATCATCAACAGCGGCGACAGCGACATCCTCCGATGGCGCTGAGAACAGAAAATCTACGTCTGCATCACATGCA
ACAACAACAGCAACAGCAACAGCCACTACGTCAGCGAGCACTTCGACCTTGCTGTCGAGCGTACAGGCTAGCTCCACAAT
AGTCAGCACTACGAGTTCCCTGAATCTGACATTTTACAACTGTGAGTGCCGATTTATTTACCGCATGGGCTTTCCTCCCT
TAGCAACTAACACTACACGCCGTACAGCTACGATTGCTTCAGGCCAGTTGCCTCTGAAGCCGGAGGTAACTCCCGGCTGG
GGAGTTGCTGGCGCCATCATGATTATTACAGGTGTGGTCTATGCCCTCATCGGCATCAAGAAGCGCTCGTTGCACATATG
TCTCTCTACTGCCTACATGACTAGTCTTGGCACTACGGTTCTGATTATATACGTTATGTCGCCACCATTCAGCCATGCAG
TCCAGGGCGGCTTTGTCGCGGCTGCCGTCTGCACCGGACTCATCTTGGGTGGCGGCGCCTTCCTCTTCAAGGAAATCACC
GAAGGCTTAGGCTGTATGCTCGGTGGTTTCTGCTTCAGCATGTGGCTGCTGTGTCTTCACAAAGGTGGTCTGCTGCCTCA
CAGCACCGGCAAGATCATCTTCATCGTCGCCTTCACCATTGGATTCTTTGCCTTCTACTGCTCTCACTGGACTCGCCAGT
ACGCCCTCATTGCCTGCATTTCTTTTTCTGGCGCCACCGTCACGGTTCTGGGCATCGATGCATTTAGTCGCGCCGGTCTC
AAAGAGTTCTGGGCCTATATCTGGAACCTCAACAACAACCTCTTCCCTCTTGGAGCCGACACCTACCCGCTGACAAGGGG
CATTCGCGTCGAAATTGCAGTCATAATTGTCATATTTTTGGCCGGCATTGTCTCTCAACTGAAACTATGGCACATCGTGC
AAGAGCGTCGTGCGAAACGAGACGCCGAGCGTGCTGAGGATGAGCGTGCTCTGCAGCTGAAAGACGAGGAACAAGGTCGT
CGGTTCGAAGAAACCAACGCACGTGAGCGGAAGGAATGGGAGGCCAAATACGGAAACGGAGAAACTGGAAGCAACAAGCA
CAACTCCACGACCGATTCGGGCGTAGGAGACATGGGGACCGAGAAGGGCGTGTCCATTGAGAGACCATCCCGGCCACAAT
CACGGATGCAGGGAGCTGAGGACGATTTAGAAGCGGCATCGGAACCAATCGAGCTGGTGGATATGCAACCTCAGCCCAAG
GCCGCAGCCGAGATGATCCTGGAACATGATGCAAAGGACGGCGCCCTCACGGTTTGCGTGGCGGCTGATGACTATCCCGA
GGGCATGCAGCCGTCCGAGACAGGTGTCGATGGTGTCGCCCCAACAGCGGATGTAGCTGCAGGGTCTACCCAGAAGTCGA
TCAGAAAGGTCTCAAACGACTCGGCAGGCGTATGGGCCGCTGGGCCGGAAATTGTGCCGCTGCCTTTCAAGATCCCAACA
ACCGTCCACGAGGAGGAAGCCGAAGCCGGAGAAAATTGCACAACCGGACAGGGCGATAACGATGACCGATCCTCCGTGGC
CACTTTTGCCGACGAAGACGAAGTCATAGTGTCAGCGTATCCGCACCGACGCTCGCTTGCAAAGCGTCTATCCCAAGGCT
CAGCCGATCTCCTGCGCGGCCTATCGAAGCGAGCAAGTCCAACGCAGATAAGAAGCAACGATGGCACAGAGCGAAATGAA
AGCAAAGAGGAGCTTTTGAGTTCGCCGCAGTCTACCGCCCTGCTTCAGGACGAGAAGGATAAGGATGACAGCAGCTCGTT
GGCTGCGACTATCGATGAAACCAGCTCCAAGGACAGCTATTCGGTACGGGATGAGGAGGAGGATGTCGACGTAATTGAGG
AGCAATCTCCACACAACAGCGAAGTGCACACAGAGCTGTCTGTAGCTATCGAAACGGTGGAACCGGTCGCCACAACGGCC
ATCCAACAACAGGAGACGACAGAGCTCTCGGCAGCTGATTTGCCGACTAAGATCCAGCAAGACGAAACGATGCCAGAGAC
ACCGAACCGCAAGACACCATCGGCCGCCTCAGCCGAGTGGACGCCGGTCAGCCTCACCAAGGAACGGCTCCCGCCGTCCT
TGTCTCGCGTTGCCATGTCATACCGCACAAACGAGTGGACCAAACACCTCGGCCATGCAAAGACACGCCAGAACCAGATG
CTCTGCAGCTTCTTGAAGCAAACCAACGGCCACAACCGGTCCAGGCCGTCGAAGCAGTGGCCGGTGCAAAAGAGGAGGAG
GCCACGACCCCGACTGACAGTGCAGCACACGGCAACGAGACGCCGCGGCCGGTAAATGTGGACGAGCTACAGCAGACAGC
CGAGACCGGAACACCGGCGCCCGCCGCTCCACGGCGGTCATCTCTGCCGGTCGCGTCCCGGTCTGGCTCATACCAGTCTT
TGGGAAACATGCCTGCGGCAGTCCGGGGAAGTGTGGGCGGTGGGTTCCGAAGCATATCGAGCGGTCACCTGGCCCGGCAC
ACGTCGGCTCTGCATAACGAGCCGATCGCGGAGGAGGACGACGCAGCATCGGCAGACGCAGATGGCCACTCGCCAACCAG
TCCCACTTCGCCGGGTCTGACGCCGTATTCCGGCCCACAAACGCTGATTGGGCGACGCGAGATGCTTCTCCGGAGCAAAT
CCCAAGGCTTCTACATCGGTGGACCCATCACGCAGCATATAGAGGCCAGCATGTCGATGCCGGTGATCCCATCGTCGGGG
ACTAGTGACAACGGCAGCGGGTCGGCACATGATCTGACAACGGCCGACCTGGATGACTTGCCGATGAATAAGCGTCATGA
GATAATGATGCGGCAGCAGAGCTATGCCAGCATTGTCGGTGCGGATGGCAATGGTGGCTCGGTGGTCCAAACGCCAATGG
CTGGCATTGTCGCCTTCGACAGCCACCAGCCAAAGCGCGGGCAGGCAAAGATGGCGACAAATACAGCGCGCCAGTCGCAG
CTGGCAGCATTCCGGAGCTCGGTGGCCCTGGATCTAAACGGTTTGATTCAAGCCCCGGCCCAAGCTGAGACTGGAAGTCC
GAGACTACGCGAGTCCGTGTCTGCACATGTGCTGCAGAACCGGTCGACGTCGACGGCGTCACTGATGCCAACACCACAGG
ATGTGGCCCACGTGAAGCAGTCGATCGAGCAGCAGCGGAACTACATGCTGGGCCTAAGAGAAGCAGAGGCGCAGCGGCGG
GAGATAAAGCTGCAAGACAAAGCGCGTACCGAGCGTGCTTTTGAGGAGCGCATGCGCAAGGGCGACCTGATGGCGGCGCA
TCGAGACGCTATGCGGCGGATGCAGGCGTCGGCGCGCGAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62