GenePrediction:GLEAN_5772 Details

Name: GLEAN_5772
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1090919..1089320 (- strand)
Length: 1600
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1090919..1090804 (- strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_173:1090745..1089320 (- strand)
Length: 1426
>GLEAN_5772 class=GenePrediction position=GCSC_173:1090919..1089320 (- strand)
ATGCCTGGTGGGGCAGCTAGCGACAGGTACAGCAGGAGCACCACCAGCATTGCTAACTGCGGCCTAGCTATCATGTCTCT
GCCAGGCAATTTTCTTTGGGGCTTTGCCACGGCCTCGTAGGTCTAGGCCTTTCTGATCCTTCACCCGTATCGATCACTGA
CCCCTCGACCTCAGGTACCAGATCGAGGGCGCCCCAGATGAGGATGGCCGAGGCCCGTCCATCTGGGACACGTTTTGCGA
GATCCCGGGAAAGATTGCAGACGGCAGCTCGGGAGCAATTGCTTGTGACTCGTACCGCCGATGGCAGGACGACGTGGCAC
TGCTGAAGTCACTGGGAGCGCAGGTGTACCGCTTCTCCATCTCCTGGTCGCGGGTGATACCGCTTGGAGGTCGCAACGAC
CCGGTCAACCACGCAGGTCTCGACCACTACGTGCGACTTGTAGATGCATTGCTGGAGGCTGGGATCACGCCTTTCATCAC
GCTGTTCCATTGGGATCTCCCGGACGGGCTCGAGAAGCGATACGGCGGGCTGTTGAGCCACGACGAGTTTCCGCTGGACT
TTGAGCACTATGCACGAACGGTGTTTGCGGCGATTCCCAAGTGCAAGCACTGGATCACGTTCAACGAGCCGTGGTGCTCG
TCGATCCTGGGCTACAGTCTGGGGGTGTTTGCGCCCGGACGCACGTCGGACCGCAGCAGGTCAGCTGTGGGCGACAGTGC
GCACGAACCGTGGCTGGTGGGCCACAACCTGCTGGTGGCACACGGACGGGCAGTGCGAGCATACCGTGACGACTTCAAGA
CGGCCAGCCCGGACGGCGAGATCGGAATCACGCTCAACGGCGACGCGACGTATCCGTGGGACCCGGAAGACGGCGAGGAC
GTGGCGGCAGCACAGCGCAAGCTCGAGTTTTCGATTGCATGGTTTGCCGACCCCATCTACTTTGGGCACTACCCGGAATC
GATGCGGGCGCAGCTGGGCGACCGACTGCCGAGCTTCACGGAAGCAGAGCGGCAGCTGGTGCAGGGCTCCAACGACTTTT
ACGGCATGAACCACTACACGGCCGACTATGTGCGGCACCGGCCGGGAAGCCCGGCGGTAGAGGACTTTGTAGGCCACCTC
GAGACGCTGCCGGTGTCGAGGGCGGGCGAGTGGATTGGACCAGAGACGCAGTCGACATGGCTGCGACCGAACCCGGGCGG
TTTCCGTACGTTGCTGGGCTGGATCAGCCGGCGGTACGGGCGACCAAGGGTGTACGTGACGGAGAACGGGACGAGCATCA
AGGGCGAAAACAGTCTGCCGACGGCTGAGGTGACCGACGACGTCTTCCGGGTGCGGTACTTTGACGAATATGTGCACGCC
ATGGCCGAAGCGGTGCGCGACGACGGCGTGGACGTGCGCGGCTACATGGCCTGGTCACTGCTGGACAACTTCGAGTGGGC
CGAAGGGTACGAGACCCGGTTTGGCGTCACATATGTCGACTATGCTGGCGGCCAGCAGCGGCATCCAAAGAAGAGCGCGC
TCGCGATGAAGGCGCTGTTTGCCAGTTTGGTGGAGCACAACCAGATACCCCAGACTTACTCCGCACCAGCAGTGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62