GenePrediction:GLEAN_5775 Details

Name: GLEAN_5775
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1072664..1066745 (- strand)
Length: 5920
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1072664..1072654 (- strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_173:1072595..1072578 (- strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_173:1072502..1066745 (- strand)
Length: 5758
>GLEAN_5775 class=GenePrediction position=GCSC_173:1072664..1066745 (- strand)
ATGGCGTCCAGGTAGGTCACGTGTCTATATCTGACCGCTTACTCCGATCGCATGCTAACAACTGCACAGACTTGACCGGC
TTGTCACGTGAGTTCAATGCGACCACAGCTTCGAGCACTCACTTCTTGCTTCGCTTTCTACCGTCTGCTAACTTCGCTAC
AGAATCCTGGAGACGGGCAGTACTCGCCTGATCCGGGATACGGCCGTCAATCAATTGGCTGACTGGCAAAAGCAACATCC
AGAAGAGCTATTCAACATCATTGGCCGAGTGGTTCCCTACTTGCGTCACAAGGACTGGGAGACGCGAAGCACAGCCGCCA
AAGCATTGGGAAAGATCATTGAACATGCCGAGCCTTACGATCCAAATGCTGACGAGCAGAAGACAGAGCCTGTAGAGCTC
AAGGAAGAGGACGAGAAAGCCAAGAAGGAAGAGCCGGAGGACGAGCCTGATGGTGTATCTGTGAAGAAAGAGGAGCAGAA
AGATACGCTTTTTTTACAGGAGGAGTTCTATGCTCTGGACGCTCTCGACATCAACTCTGTCCTAAAGTATGGTCGAGAGC
TACTCCGCGGAGGCAACCCTGACCTAGTTCTTGCTGCGTTGGGACCTCAAGATCGCTTAACTCACCAGAAAAAGACACTG
AATGGCCGTCTGGGGCTTTTGGGGCGGTTGTTTGAGGATGACGAGATCCCTATTCCAATCGATGCCATAAAAAATGGCAG
CAGTGGCAACGGCGACGAGAACGCCCTCTCAACACCACAGGAGTCATCCGGCGCCAATGGACACGGTCACCACGAGAACG
GGGATGCAAACGGGTCGTCGAATACGACGGGCCAGCACTCGGACGAATACGGAGGACTAAGCTCCCGGCAACTGAACGTT
TTGAAGCGCAAACGGAAGCGCGAGCTCCAACGGGCAGCCCAGGGAAAGAGCGGATTCGGCGACCTGTCACTTCGTCGTAC
CGCTACAGGAGGCACCGAGGCGTTTGGTGACGAATCCCTTCTTGATGGCGATATGAAGAAGAACGGCAAAGTCACAGAGT
ACTTCAACCTCGAGAGGCCAAACGATGTAGACGAAGAAACAAAGGTCGTTTCGGAATTCAAAGGCCCCGTGGTGCCCATC
AAGGCAGAAATCGATGTTGACGAAGGCGACGGGGGGGTGGAATGGCCGTACGAGCGTCTGTGCGAGTTCTTGAAGGTCGA
CTTGTTCGATCCGGGCTGGGAGACACGGCACGGTGCTGCCATGGGCTTGCGGGAGATTATCCGGGTCCACGGTGTCGGTG
CTGGTCGAGAGAAGGGCAGGACTCGCGTCGAAAACGACGAGGCCAACCGCAAATGGCTAGACGACCTTGCCTGCCGACTC
TGTTGCGTCTTGATGCTCGACCGGTTCACTGATTTCAGCTCGGACACATCGGTTGCACCGATCCGTGAGACTGTTGGCCA
GACGCTCGGTGCGGTGCTCTTCCATGTGCCGGCAGAGTCGGTGCACTCCATCTATCGCATTCTCTTGCGCCTGGTCATGC
AGGAAGACCTGCAGCTCGACCGCCACGTCTGGGCTGTATGCCACGGCGGCATGGTCGGTCTGCGCTACGTCGTGGCCGTG
CGCAAAGACCTGCTTCTCCAGCACAGCAGCATGATCGATGGCGTTGTCAGTGCTGTGATGAAGGGCCTTGCGGACAACGA
CGACGATGTCCGGTCTGTCAGCGCTGCGACGTTGATCCCAATGGCAAAGGAATTTGTCACTATGCGGCCGTCTGCCCTGG
ATGGCCTCATCAACATCGTGTGGGAGAGCCTATCGAGTCTGGGCGACGATCTGAGCGCGTCAACTGGCAAGATCATGGAC
CTACTCGCCATCCTGTGCAGCTTCCCACAGGTGCTGGATGCCATGAAGACTTCGGCGGAGAAGGACGAGGAGCGGTCCTT
CACGCTGCTCGTGCCGCGGCTGTATCCTTTCCTGCGCCACACCATCACATCCGTCCGGCTTGCGGTGCTCAAGGCGCTCA
TGACATTTGTTCACATCGACAACGAGACCTCCCAGGGTTGGCTCAACGGCCGGATCCTACGGCTCGTGTTTCAAAACATC
ATTGTGGAACGAGACAGAGAGACGCTGTCAGCATCGCTCGATCTCTGGTCTTCCCTCGTCCGGTGTCTGGCGAAAGCGGA
TGCGGCAGCGCTGGCTCTCGAGTTCCATCCGCATGTGGATGCCATGATGCAGCTGACGCTTCACCCTATCGGCGTGTCGC
GAAACCCGATGCCGATGAAGCCAGGGCTGTTCCTGAAGCCGTCAGGCGGCGTGTATGCAACGCCCAGCAGCTGGACCCCG
AGCTCGGCCCGCAAGGCGTCGCCTCCAGATAGCGTCGAACGATCGGTCAAGCGACGACGGAAATCTACGCGGGTCGACGA
CACGCCGGTCACGACGAGCTCCCACGACGTTGACGGTGCGATGATGCAGGGTGATGTCGACGTGGTTGGCATTGAAACGA
TGGTGCGGTCGCGCATATCGGCAGCGAAGGCGATGGGACTGCTGATGTCCTTGGTGCCAACGGCGGAGCTGGAAATGTAC
GACGCCAGCATCCTGCCAGGGCTCACATCTGCACACTCGACGACGCAGCTGGCAGCGTGCACGGTGGTGGAAGAGTACGC
AAAGGGCTGTGGGGAGGCAGCGGAGAGCAAGCGGTTTGTGGAGCCGCTGCAGAAGATTGTGGAGACGGAGCGGCCGTCGC
ACTACAGCGATCTGGTCAGCTTCATCCAGCGGGTGCGCTCGCAGTGCTCGCAGCTCATCCACATGTTCCGGGACCACGGC
AAGGTATCGGAGGCGCGGGTGCCCCGTCTGGCGCCGCTCTGTCAAGGCGAACCGGCGGCCGGTCCGGAGGCGTTCTCGGT
CACGCATGCGGAGAAAGTTGTGAAGGAGGACTTTGAGAAGCTGAAGCGTATCATGGCACCTGGACAGCGGCTCATAGCCA
GTCAGCACCTGTCGGAGGCGCGGGACTCTGCGATAGAGGCCATCAAGGAGGCCAAGACGGCCAAAGAGAGCCGGGACATT
CGAATTCGGGCGGCGGCAGCGTGCGGCCTCGTGGCGATGAAGATTCTTCCGAAGAAGCCGAGCCCGCTGATCAAGGCGAT
TATGGACAGCGTCAAGACAGAGGAGAACCAGGACCTTCAAAACCGGTCAGCAGCGACAATCGCGCGGCTCGTGCAGCTGT
TCACGGAGACAGGCCGCCGCGGACCAGCCGACAAGGTGGTCTCGAACCTGGTTAAGTTCTCGTGTGTCGAGGTGGCTGAG
ACGCCCGAATTTCCGGTGCATGCGGCCAAGCTCACTGTGATCCTCTCGATGCACAAAGAGGAGGACCGTGTGGACCACGC
GGACGCGGTGAAGTGGGCCAGGGAAGCCAAGGCGGCCCGTGTGACGCGGCGTGGTGCCAAGGAAGCACTGGAGAGGCTGT
CGCAGAACTTTGGGCCGTCTGTGCTGGAAAAGGTGCCGAGCCTGCGGACGTTTATGGAAGAGCCGCTGCGACGGGCGTTT
TTGGACACTCTGCCAGATGAAGCACGTGACCCGGAGCAGACATTTGGGCAGGAGATTGTGGATGCAATGTCAGTGATGCG
GATGCTGACGCCGACATTCGACGAGGCTGTGCGGCCGTTTGTGCTGGAGATGGTGCCGCTGGTGATCAAAGCACTGCACT
CGGAGCTGTCGGTGTTCCGGTACATGGCCGCGAAGTGTCTGGCGACGATCTGCAGCGTGATCACGGTGGAGGGCATGACG
GCGCTGGTGCAGCAGGTTTTGCCGTCAATTAACAACCCGGTCGACCTGCACTACCGACAAGGGGCGATCGAGGTGATCTA
CCACCTGATTGCGGTGATGGGCGACCGGATCTTGCCGTACGTGATCTTCCTGATCGTGCCGGTACTGGGACGGATGAGCG
ACTCGGACAACGAGGTGCGGCTGATTGCGACGACATCGTTTGCGACATTGGTCAAGCTGGTGCCGCTGGAGGCAGGGATT
CCGGATCCGCCGGGGCTGTCGCCGGAGCTGCTGGCGGGCCGCGACCGCGAGCGGACGTTCATCCAGCAGCTGCTGGACCC
GAAGAAGATCGAGCCGTTCCACATTCCGGTGGGCATCAAGGCCGAACTGCGGTCGTACCAGCAGGAAGGCGTCAACTGGC
TGCATTTCCTCAACAAGTTCCACCTGCACGGGATTCTGTGTGACGACATGGGCCTTGGCAAGACGCTGCAGACAATCTGT
ATCGTGGCGAGTGACCACCACCAGCGGGCGGAGGAGTTTGCGAAATCGGGAGCGGTCGAGGTGCGGCGCATGCCATCACT
GGTGGTGTGCCCACCGACGCTGTCGGGTCACTGGGCGCAGGAGATCAAGGCGTACGCGCCGTTTCTCAGCGTGGCGGCCT
ATGTCGGGTCTCCGGTGGAGCGAAAGGGGCTGCGAGGCGGGCTGGGCGAGACGGACATCGTGATCACGTCGTACGACGTG
TGCCGCAACGATGTGGAGGTGTTGGAGGCGCACAAGTGGAACTACGTGGTGCTGGACGAGGGCCATTTGATCAAGAACCC
GCGGACGAAGATCAGCATGGCGGTCAAGAAGCTGCAGAGCAACCACCGGCTAATCCTGACGGGCACGCCGATCCAGAACA
ACGTGCTGGAGCTGTGGTCGCTGTTCGACTTCCTGATGCCGGGCTTCCTGGGAGCAGAGAAGGTGTTCATGGACCGGTTT
GCCAAGCCGATCGCGGCCAGCCGGTTCGGCAAGGCTTCGTCCAAAGAGCAGGAAGCAGGGGCACTGGCAATCGAAGCGCT
GCACAAGCAGGTGCTACCGTTCCTGCTGCGGCGGCTCAAGGAAGAGGTGCTGGAGGACCTGCCGCCGAAGATCCTGCAGA
ATTACTACTGCGACCTGAGCGAGCTGCAGAAGAAGCTGTTTGACGACTTCTCGCGACGCGAGTCCAAGAAGATTGCCGAA
GAGGCCGGGCGGGACGACAAGGAGGCCAAGCAACACATCTTCCAGGCGCTGCAGTACATGCGCAAGCTGTGCAACTCGCC
GGCGCTGGTGATGCGGCCAGGACACCGGATGTACGACGAGACGCAGCGACTGCTGGAGCGACAGGGCAGCAGCATCGAGG
ACCCGAACCACGCGCCGAAGCTGACGGCCCTGCGCGATCTGCTGGTGGACTGCGGCATTGGGGTGGAGGGCGACGGAGAC
GGCAGTGACCCGCTGTACCAGCCGATCAAGCCGCACCGAGCGCTGATCTTCTGCCAGATGAAGGAGATGCTAGACATGGT
GCAGAACACGGTGCTAAAGAGCATGTTGCCGTCGGTGTCGTATCTGCGGCTGGACGGGTCGGTGGAGGCGAACCGGCGGC
AGGACATTGTCAACCGATTCAACAAGGACCCCTCGTACGACGTGCTGCTGCTGACGACAAACGTGGGCGGACTGGGGCTG
AATCTGACGGGTGCCGACACGGTCATCTTTGTGGAGCACGACTGGAATCCACAGCGAGATCTGCAGGCGATGGACCGGGC
GCATCGCATTGGGCAGAAGAAGGTGGTGAACGTATACCGGCTGATCACGCGCGGGACGCTGGAGGAGAAGATTCTCAGTC
TGCAGCGCTTCAAGATCGACGTGGCCTCGACGGTGGTGAACCAGCAGAATGCCGGCCTGGCGACGATGGACACGAACGAG
ATCCTCGACCTGTTCAACCTGGACGACTCGGGGCCGAATCTGCTGACAGACAAGGGTAGTGGTGCGGGTGGTGGAGACGG
GGGCGGCGTGCGGGAAGAAGACATGGTCGACATCGAGACGGGCGACGTGCGCCAGCCGGGAAAGAAGGCTGCCTGGTTGG
AGGAGCTGGATGAGCTCTGGGACAACCGGCAGTACGAAGAGAGCTTTGACCTGGACGGGTTCCTGCAGACGATGCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62