GenePrediction:GLEAN_5776 Details

Name: GLEAN_5776
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1066390..1064713 (- strand)
Length: 1678
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1066390..1066367 (- strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_173:1066307..1064934 (- strand)
Length: 1374
Type: CDS
Source: GLEAN
Position: GCSC_173:1064871..1064713 (- strand)
Length: 159
>GLEAN_5776 class=GenePrediction position=GCSC_173:1066390..1064713 (- strand)
ATGCCGGTCGACTACAGCAAATGGGTAAGCAAGGGGGATCTGATGGCAGGCTTCGTATATCGGTACTGACCAGACAATGA
CAGGACGCGCTGGAGCTCAGCGACGACTCGGACATTGAGGTGCATCCGAACGTAGACAAGCGGTCGTTTATCCGGGCGAA
GCAGAACCAGATTCACATGGAGCGGCAGCAGCGGCGGCACCAGATTGAGACGCTGCGGTACGAGCGGCAGATCAACGACG
GGCTAGCGCGGCGGATCGCGGGACTGCTGGCGGTGCTGCGATCGCACGCGGACGAGGCGCGAGCGAGCAGCGATGTGAAC
GCAGCAGGAGCGGTGGCGTTCCGGGCCGTGATGGAGAACGCGTCGCAGATGAAAGCAGGCGAAGACCGGCCGCCGAAGCC
GCCGGCGGGGGTGCACGCGGCTGTCGAGCAGCCGGAGACGTACACGAAGATGATGGCGGCGCTGCTGGACCAGGTCAACA
AAGCGCTGGCAGAGCGGCAGCTGGAGGGCGCAGCACGCTACGACGCCATGGTGGCCGAGATCGAGGGCCACGGGGACAAG
GTGGCCGACCTGCAGCGACAGCTGGAGCAGAAGCTGGCCGAGCTGGAGCGCGAGCAAGCGCGCAAGATCACCAGCGACAG
CATCCACACGGGCTTCAACAGCTCGCACGTGACCAAGGCGACAGCAGAGCCAGGGGACAGCGGGGGGAAGACGGAGCTGC
TGAATCCAGGGTATGGTCTGGGCGGCAGCACGGCGACGAAGGCAGCCGAGAACACGATGACAACAACAACAGCAGCAGCA
GCAGCAGCAGGCATCGACGACGACGACGACGAGGTTCCGTCGACGTCGGAAGCAGCACGGCAATTTGCCAACATTCGGCC
GGGCAGCCACGCCGAGAGCCAGGCATTTATCCGGACGCATCCGGAGCTGGTGGCATCGGACCGGGAGCTGGAAGGCATCC
TGGTGATGGCGTTTGACGCCGAGTTTGCGGGTGACAGCGAGGCAGCGCGACGGTTTGTGCACCAGGCGACGCTGCTGGAG
TTTTGTCGAGCGCTCGGCCGTGACGGCGTGCTGCTCTTCTTCAGGCGCATGGCGACGGCCGGCCACCAGGCCCAGGACGT
CTTCCGCCGCGACGTGCAGGAAAAGTACGGCCGGATCCACGAGCGGGTGCGCGAGATCAACGCGCAGAAGGCGGCCAGCG
CGGCCAGCGGCGTCGACGGCGTCGAGCAGATCCAGCGGCATGCCGTCGAGCCCGGTACCGTCATCAACATCCACATCCCG
CCGACCGGCAGCGAATCCGACGTCAGCAGCGAGACCTTTGCCGCACGGCGCATCTTTGACGGCTTCCGGCCCGAGATGAA
AAAGGCCCTCGAGTCCGGCAGCCTTGACCGGGTCAATGAGGTGTTGGGCCGGATGACCGTGACGGATGCGGAGGCGCTGG
TCGGCCAGTTTTCCGAGGTGAGTCCGGACGTTTGGGGCTCGTCTAGGCAGCGTCCTTGTGCTCACATCTCACATCCCAGG
CCGGCATCCTCAGCATGGAGGACGAGATTATCGACGCGACCACCGAGGAGGGCCGACAACAGCTCAAGGAGATGGGCCGG
GAGGACGAGGACGAGGTCGAGGACGAGACGCCGGCCAAGACCGAGACCAAAGAGGAGGAATACCCAGACCCGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62