GenePrediction:GLEAN_5778 Details

Name: GLEAN_5778
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1052913..1050572 (- strand)
Length: 2342
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1052913..1052775 (- strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_173:1052702..1052553 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_173:1052502..1051843 (- strand)
Length: 660
Type: CDS
Source: GLEAN
Position: GCSC_173:1051776..1050572 (- strand)
Length: 1205
>GLEAN_5778 class=GenePrediction position=GCSC_173:1052913..1050572 (- strand)
ATGTGGTTTGCTGCAGTCAACTCGGCCGTGCAGCTCGCAAGTATGGTTTGCTTCCCAAACGGCTTCCAGCTCCAAATTGA
CTTGCCACTTGCTGATCCTGGACTGCTAGAACGAGCTGCCGACGAGACCGACTCTGAAGGTGCGCACAGGGATGGATTGC
GCAGGGCCGTGCGGCTGCGGACGGGATTGTACTGACGTTTTTCTTTTGCAGGCCCCGACTCGTCCGCCGAGAAGGAGATC
TACGCATCATGGGCCATCTTCATTCTGATCATGCTGCTCATCGTGGCCTTCTTCACCAGCTACACGCTGCAGCGGATGAA
GGTCACGGCCGTGCACGAGACGGTGGTGTCCATCTTTGCTGGTGAGTGGACAGGCGGCTTCTGTTTGGCAGCCGCGGCTG
ACTTCTGCTAGGCATGATTGTCGGGCTCGTTCTTCGCCTGAGTCCGGGCGATAACATCCGCGATCTGGTGAGCTTCGACT
ACCAGATCTTCTTCAACCTGCTTCTGCCGCCCATCATCCTCTCGTCGGGCTACGAACTGCATCAAGGCAACTTCTTCCGC
AACATCAGCACAATCCTGACGTTTGCGTTTGCCGGCACGTTCCTCTCGGCCATTGTGATCGGCGTGCTCCTCTGGCTGTA
CACGCAGCTGCCGCTGGAGAGCCTGACGATGGATTGGATTGACGCAATCTCGGTGGGCGCCACGCTCTCGGCCACAGACC
CGGTCACAATCCTGGCTATCTTCAATTCGTACAAGGTGGATCCGAAGCTGTACACGATTATCTTTGGCGAGTCGATCCTC
AACGACGCCGTGGCCATTGTCATCTTCGAGTCGGCACAGAAGTCCAAGAACGGGGCGGCCAGCTCGTCCAGCATCGTCAG
CCTGCTCAAGGTCGTCGGCATCTTCCTCAAGGACTTCTTTGGTAGCCTGATCATCGGTGCGCTGGTCGGCATCGTGGCCG
CCCTCTGCCTCAAGTACACCTACGTCCGTCGTTATCCCAAGATCGAGGGCTGCCTGATTGTGCTTATTGCCTATGCGACC
TACTTTTTCTCCCAGGCCATCAAGATGTCGGGTATGTCTTTGCTCTCTCGCTCTCTTTCTCCCTCTCTGGAGCTAACAAA
TCGCTAACAACGGGTAGGTATCGTATCCCTTCTGTTCTGCGGCATCACGCTCAAACACTACGCCTACTTCAACATGTCGC
GCCGCACGCAGCTGTCGACCAAGTACATCTTCCAGGTGTTGGCTCAGCTGTCGGAGAACTTTATCTTTATCTACCTGGGG
GTGTCACTCTTCACGGAAAAGGACCTGCAGTACCAGCCGCTGCTGATCATCGTGACGGTGATTGCTGTGTGCGCGGCGCG
CTGGGTGGCCGTGTTCCCGCTGTCGTGGGCGATCAACCGGATCACGCACTACCGGCAGCGGCGGCGCGGCATCATGAACG
CGCCGGACGAGCTGCCGTACAACTACCAGGCGATGCTCTTCTGGGCCGGGCTGCGCGGAGCGGTGGGCGTGGCGCTGGCG
GCGCTGCTGACGGGCAAGGACACATATGCGCTCAAGGCGACGGTGCTGGTGGTGGTGGTGCTGACGGTGATCATCTTTGG
CGGAACGACGGCGCGGATGCTAGAGATTCTGGGCATCCGAACGGGTGTGGTGGACGAGATGGACTCGGACGACGAGTTTG
ACATTGAGCCGATCGGCAACGGCGCATATGCAAAGCAGTCGGGCAGCGGCTTTGGCTACGATCCAACGCGTGTTGCCGGC
GTCGGTGGAGCGGCTGCGAGCTCGTCGATGCCGTTGGACCGGATTGGACGACACGCAAACGGCAGCAACAGCAGGGGTGG
CAGCAGAGATGGAGGTGGTGGTGGCGGTGGTGGTGATGGTGGAAACAACAACAGCTGGACGACAGGCATGCGACCATCGC
ATCCTGGACTAGCAAACGGCAGCAGCGGAATCGTGGAGCGGCCGTCGAGTCTGAGCCGGAAGAACTCGCTGCGCGATCTC
GACGCGGCCGAACAGGCCGAGCTGCTGGGCACCGCAGCCAGCGCGACCAACTCAGAGGTGGGCAGCGACATTGACACGTC
CGACTTGCCACCGCCGGCGCCGTGGAGACGGCCGAGTCCGTTGCCGCCAGGACAGACCAGGGGGCCCGGTGCAGGTGACA
GCAGCAGCGGCAGCAGTGGTGGTGCTGCTGCAGGGGGCATGACGGCCTCGGCGGCTTTCCGGCAGCTGTTCAGCACAGAG
GACGCGTCTGCGCTGCTGCAGCAGCTTGACGAGGACTATATCAAGCCGAAGCTGCTGCTGGACGGTGGCAACGGCCGGGG
CAACGGCGGGTCGCCGGTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62