GenePrediction:GLEAN_5781 Details

Name: GLEAN_5781
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1037221..1034996 (- strand)
Length: 2226
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1037221..1036392 (- strand)
Length: 830
Type: CDS
Source: GLEAN
Position: GCSC_173:1036306..1035185 (- strand)
Length: 1122
Type: CDS
Source: GLEAN
Position: GCSC_173:1035110..1034996 (- strand)
Length: 115
>GLEAN_5781 class=GenePrediction position=GCSC_173:1037221..1034996 (- strand)
ATGACGACCAGCGAGCTATGGCGCCACCCCAGCCCACGGGATACGCCCATGCACCATTTCCTCGAGGCTGTCAATGCCAA
GCACGGCCTGGGTCTCACCGACTATGACGGCCTGTATCGCTGGTCGGTCGAGAACGTCGCCACTTTCTGGGAGGACGTGT
GGCACTTTGTCGGCGTGGCGGCGTCCAAAACGTATGACCGCATCCTGCCCACCACGGCCATGTTTCCGCGCCCAGACTTC
TTCTCTGGCGCGCGCCTGAACTTTGCCGAAAACCTGCTGTTCCCGGCTGGCGTAGAGGTCGACTCGACGGCGCCGGCACT
GATCACCGTCACCGAGGCCTGGGACAGCAGCGATGGTGGCAGCAGCACGGCCACCGCGCCCATGGTGACGACGTCGTGGG
CCCAGCTGCGCGATGCCGTCCGGCTGTGTGCCTCCGGGCTGCGTAGTCTGGCCATTGACCTGCAGCCGGGCGACGTTGTG
GCCGGCTTCGTGGGCAACCATGCCGAGGCGATCGTGGCCATGCTGGCTGCGGCATCGATCGGCGCCGTGTGGACGTCCAT
GAGTCCGGACAATGGTGTCAGTGCCGTGCTCGACCGGCTGCTGCGCGTGAAGCCCAAGGTGCTCTTCGCTGACAGCGCTA
CCATCTACAACGGCAAGGTCTGGCCGAGCATGGACAAGACCCGGCAGATTGCCGAGGCGCTCAGTGGCAGCCTCAAGGCC
GTCGTCATCATCTCGGCACATGACCCGGCTGCAAGGGAGAACGGCGTCGACCTCGATGCCCTCAAGCCCAAGACTGCCTT
AGTGGAGCATTATGCCGCATTTTTGTCCAGGTAGGTTCTTCTCTCTGTCTGTCGGCGTGGCTTGATATGCTTGGAGTGGA
CGCGGGCACTGAAAGGAAACGTTTCAACTTCATAGCGCGCCTGATGCGCCTCTGAAATTCGAACAGCTTCCGCCCTCGCA
TCCACTCTACATCCTCTACTCCAGTGGAACGACCGGCCTGCCGAAGGCGATCGTGCACACTTCACTGGGCACGCTCATCC
AACACAAGAAGGAACACGTTTTACACTGCTCCCTCGGCCCAGCGTCGCGCATGCTCTATTACACAACCACGTCGTGGATG
ATGTGGCACTGGAGCGTGTCCAGCCTGGCCGTCGGCACGTCTTTGGTGCTATACACAGGCTCTCCCTTCAAGCCTCAAGG
TCCCCTCTCCCTTCCCCGGCTGCTGGCAAAGCTCCGCGTAACACACTATGGCACTTCGGCAGCCTACCTCACTGCGCTCG
AGTCCAGCCACGTGCGGATTCCGTCAGACATCGACCTGTCTGCTCTCGAGGCCATCTACTCGACCGCGTCTCCGCTCCCA
CCCTCAACGTTTGCCTATGTGTACGCCACATTCCCCAAGCGGGTCCACCTTGCATCCATCACCGGAGGCACTGATATCAT
CTCGCTGTTTGGTGCTCCATGTCCGCTGCTGCCTGTAGTCGCAGGTGCCGTGCAGTGCGCCGGGCTGGGCATGGCGATTG
CCGTGGCCGACTCGGCATCGCCATCCGACCACCCGCAGCTTGTGGCCGCTGGTGAGGAGGGCGACCTCGTGTGCACCGAG
CCGTTTCCTTGCCAGCCGCTGACATTTTACGATGGCGACGCCAAGTACCGTGCGGCCTATTTCGAGCGGTTCGAGGGCTG
GTGGCACCATGGCGACTTCGTCCGGCTGCAGGGCCAGTCGCTGGTGATGCTGGGCCGGTCTGACGGTGTGCTGAAGCCGT
CTGGGGTGCGGTTTGGTAGCGCCGAGATCTACAACATTCTGACTCGATTCTTTGCGGCCGAAGTGGAGGACGCCTTGTGT
GTGGGTCGGCGTCGCCCCCAGGACACTGACGAGACTGTGTGCCTATTTGTGGTTATGGCGCCCGGCGCAGCGGCTTTTGA
CGACACCGTGCGTAGCCGGATCAAGTCTGTTATTCGGAGAGAACTCAGTTCACGCCATGTGCCCGGCATTGTTGAAGAAT
GTGGAGGCGGCATCCCAAAGACGACCAACGGGAAGAAGTGGGTCCTCTCCTCTCCTATCATCTCATGCCTCTTTTGAGTT
TCACGTTACTAATCAAGCCCAACCTCTTCAGGATCGAAGTCGCGGTCAAGCAGATTCTCTCCGGCATGGCTGTCAAGACA
AACGCCAGCGTGGCGAACCCCGAGTCGCTCGATTGGTTCCGTTCATGGGCCAAGGCGCACAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62