GenePrediction:GLEAN_5782 Details

Name: GLEAN_5782
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1032132..1031037 (- strand)
Length: 1096
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1032132..1032003 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_173:1031928..1031210 (- strand)
Length: 719
Type: CDS
Source: GLEAN
Position: GCSC_173:1031150..1031037 (- strand)
Length: 114
>GLEAN_5782 class=GenePrediction position=GCSC_173:1032132..1031037 (- strand)
ATGGATTCCCAACGGCAAGGCGATGTGTCACCTGAGGCCATGCAGGCGAGGATCCAGCAGGCACGTCGTGAAGCTGAATC
GCTCAAGGATCGCATTAAGCGGAAGAAGGATGAGCTTGCCGACACAACGCGTCAGTTTTTGTCTTCCGTCGCTTATGGGC
TTATCTAATCCTACCGTATACGCAATACTGATAATTCTCCGCAGTCCGAGCTGTCGCTCAGCAATCTCACGAGTCGGTCT
CCCGCAGCCAGATGATGAAGGCGAAGCGCACCCTGAAGGGCCATCTGGCCAAGATTTACGCCATGCACTGGTCTACGGAC
CGGAGGCACCTCGTGTCCGCATCTCAGGACGGCAAGCTCATCATCTGGGATGCCTACACGACGAACAAGGTCCACGCTAT
TCCTCTGCGGTCCTCGTGGGTCATGACCTGCGCCTACGCCCCGAGCGGCAACTATGTCGCGTGCGGTGGTCTCGACAATA
TCTGTTCCATCTACAATTTGAACCAGAACCGTGATGGACCGACGCGTGTCGCTCGCGAGCTGTCCGGCCACGCCGGGTAC
CTTTCCTGCTGTCGCTTTATCAACGATCGAAGCATTCTGACGTCTTCTGGTGACATGACATGCATGAAGTGGGACATCGA
GACCGGTACGCGCGTCGTCGAGTTTGCCGACCATCTGGGCGATGTCATGAGCATCAGCCTGAACCCTACCAACCAGAACA
CATTCATCTCGGGCGCTTGCGATGCCTTTGCCAAGCTCTGGGACATCCGCGCCGGCAAGGCCGTCCAGACTTTTGCTGGT
CATGAGTCTGACATCAACGCCATCCAGTTCTTCCCGGATGGCCACTCTTTCGTCACTGGGTCTGATGACGCTACATGCAG
ACTCTTCGACATCCGGGCTGATCGCGAGTTGAACGTCTATGGGGTGAGTTGGATCTGTGGCGTGATTGTGGCGTTAAGGA
CTGGAGCTAACAACCTATGTAGTCCGAGTCCATTCTGTGCGGCATCACATCCGTGGCTACATCTGTGTCTGGCCGGTTGC
TTTTTGCTGGTTATGATGACTTCGAATGCAAGGTGAGAGCAGCCGTGGGGTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62