GenePrediction:GLEAN_5783 Details

Name: GLEAN_5783
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1028062..1027095 (- strand)
Length: 968
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1028062..1027421 (- strand)
Length: 642
Type: CDS
Source: GLEAN
Position: GCSC_173:1027349..1027095 (- strand)
Length: 255
>GLEAN_5783 class=GenePrediction position=GCSC_173:1028062..1027095 (- strand)
ATGTCATCGACCGAAGCTCAGGAGGAGTTCCAGCGTTTCGTGGATAAAAATAACGAAGGACCAGCCGAAGACCGCAACCT
TCATCCGGAAGACCGTTTTGATCGACAACGCGAGGCATCCGCTACTGCTACCGACCCCGACTACCTCAACGAAGAAGAAC
AATATCGTTCCCGCCAAATTGACGACGCAATGCGCATTCCTGGCAACAACGGTTTCAACGTGCAACTGCCGCCTGCATCC
TTCGATTCTGGTCGCGCCACAGGTGTCAAGGGTGTCATAGCCGATGCTCGAAGCTACGAGACAGCCCGGCAGTCGTCTAG
GGTGAACCGGACACGAAATGTCCGGCGTAGCATCTTTGGCGGTGAGCTAGGCTTCACCAGCAACGGCAATGAAAAGAGTG
ACTCTGAGGAGGACCCACTGCAAGAAGAAGAGGAGGAAACGTTTCTGGCCCAGTGGCGTGAGTCTCGCCGCCGCGAGCTG
GAGGACGAGTCCCGATCAGGAAGTGCTGTCCGCACACGCCGCACGTCACCGAGTGTGCGCATCTACGGTCGGCTCGACGC
GGTCGATGCTCTGGGGTACCTAGATGCCATCGAAAAAGTCGGCCACGAGACTGTTGTTGTCGTCTTTGTTTATGATAACG
AGGTAGGCTATTTCTGTTACTGTCCCTTCTACCGCATGTCTTCATTGAGGCACGACTTTACTGACCGTCCCAGTGTCAAG
TATCGTCCGCAGTCGAGTCGGCGCTGAGACCAATTGTCAGTGCGAACCCTACCGTGCGCTTTGTCAAAGTTCAATACGAC
GACATCGAGTTTGACAACGCCGCCGTTCCATCCATACTTGCCTACCGCAACCAGGGTGACCTTATTGCCAACCTGACGGG
TCTGATTGAGCTGCTTCCTGGCGAGGATGACGATGCCTTTTCCAGTGATGCCCTGCGGAAGCTGCTGCAGTCACAGGGAG
TGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62