GenePrediction:GLEAN_5785 Details

Name: GLEAN_5785
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1020100..1018548 (- strand)
Length: 1553
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1020100..1019900 (- strand)
Length: 201
Type: CDS
Source: GLEAN
Position: GCSC_173:1019824..1019093 (- strand)
Length: 732
Type: CDS
Source: GLEAN
Position: GCSC_173:1019027..1018548 (- strand)
Length: 480
>GLEAN_5785 class=GenePrediction position=GCSC_173:1020100..1018548 (- strand)
ATGCCGGCCAAGCTGCCAGTCTCGCCGGCCAAGGAGCCTTTCCCCCTGCTGAATGTCGACGCTCCCGACAACACAACCCC
ATCTTCGGCGTCACAGCATGGGGCCGTTCGTCGGTCAGGGTGGACAAGCGAAGGCAATGGCGCTCTGGCCACCAGTCTGG
CCCATCTGAGCGGTGTTGACATGGCCGCGGGCAACAACAAGGTGAGTTTCGGCTTTTCGATCCTGCTGACGGAAGACGGT
TAGAAGACGACGAACCACAGCAGCTGACACGGGTAGAAGCACGACTTGTCGCGGGACAAGCGGCTCTCGAAGCGACGGAA
GGCTCGGTCGCTGGTCCGCCGGGTCAAGCAGTTCACCACACGCCACACTTGGATCTTGCCGCTGGCCATCGCTCTCGTCG
TGCTGTCGGGCTACGCTGCCTATCCATCCGAGTCCAACCCGCTCTCCCACTTCATCTTCCTCTCGTACCGCCTGCCGCTT
GCAGCTGATGCCGACCCGGACGCGTCACCACAGTATGGCAAGGGCCTCTGGGATATCGCCTTTGTCGTCTTCTACACCGT
CGTCCTCACCTTCACCCGCGAGTTCTTCATGCAGGAGGTCTTCCGGCCACTGGCCCGCTTTGCCGGCCTGCGCTCTAGGT
CAAAGCAGGCCCGCTTCATGGAGCAGATGTATACCGCCCTCTACTTTGGTGTGCTGGGTCCTGCTGGCCTTTACGTCATG
TCCAAGACGCCTGTGTGGTTCTACAACACCCGCGGCATGTACGAGAACTTCCCCCACAAGACGCACCTGGCCATTGTCAA
GTTCTACTACCTCTTTGAGGCTGCCTACTGGGCCCAGCAGGCTGTTGTTCTCATGCTGGGCATGGAGAAGCCGCGCAAGG
ATTTTCGCGAGCTCGTTGGCCACCACATCGTCTCTCTGTCTCTCATCGCCCTGAGCTACCGTTTCCACTTCACTTACATC
GGCATTGCTGTCTATACCACCCACGACATTAGCGACTTTTTCCTGGCCGTACGTTCTCTCTTGCCTCTCTGTCGTCTCTG
CCTTTCTGTCCTGATCTCTAACTCCCTCTCCAGACATCCAAGTCCCTCAACTACGTTGACGGCCCGCTGATGGGACCGTA
CTACTTCACCTTTATGTGCGCGTGGGTGTACCTACGCCACTATCTCAACCTGCGCATCATCTACAGCCTCTTCACCGAGT
TCAAGACCGTCGGCCCCTACGAACTCAACTGGGAAACAGAGCAGTACAAGTGCACCATCTCCTTCGTTATCACCCTAGCT
TTGCTGGCAGCGCTGCAAGCCCTCAACCTGTTCTGGCTGTATTTCATTGTGCGTATCGCGTACCGCTTCGTTGTCCATAA
CGTCGCCAAGGACGAGCGCAGCGACGGTGAAGAAGACACCGAATTCGAGGACTCGCCCAAGGACGGAGAAGCTTCGGTCG
CCGAAAAACAAGCGCTGCTCGACAGCAAGGCCGATGCCGCTACGACAGCGGCAGCTTCGCCTCTTGCGGCCAACGGAAAC
ACCAAAGTCAACGGTGCCGCCGCCAAGAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62