GenePrediction:GLEAN_5786 Details

Name: GLEAN_5786
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1006388..1002408 (- strand)
Length: 3981
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1006388..1005899 (- strand)
Length: 490
Type: CDS
Source: GLEAN
Position: GCSC_173:1005290..1003482 (- strand)
Length: 1809
Type: CDS
Source: GLEAN
Position: GCSC_173:1003420..1002572 (- strand)
Length: 849
Type: CDS
Source: GLEAN
Position: GCSC_173:1002511..1002408 (- strand)
Length: 104
>GLEAN_5786 class=GenePrediction position=GCSC_173:1006388..1002408 (- strand)
ATGTTGTCAGTGCCATTGATGCAATGCAATGCTTCCTTGCGTGATTACCTAGACGTGCTGTTCTGTGCTGCCGCTATCTA
CGATATAGCATTTATCTGTCCGTTGGTCGTTCTCGCATCTTGTTCGCCAGGCCTCTGCTGTCTGGCAGCTGGCCAATTAG
CCTCTCCCTGCACCACCTCGCCCGAAGGAGCGCACCTCCACTATTGGCAGGAGCCGCCAGCGGCGCAACAGGCAGGACCG
ATCTTCAGCACAGCCCCTCTGGCGGGACCTCTGGCCAGCTACGAGTATTGGAAAACGAAGAGGAAAAACCAGCATCAAAC
AAGACAACCGTGGCCTCGAAAGTTTGAATTGGCGCAGCCGCCGCAGATTGACAAAAGACCCGGCCTGCTGCGACGTAGCA
CCCCGAAGAAACCGCCGGGCCAGCCATACACAGGAGACACAGCCCTGTCCCGTTCCGGCATCGATCCCAAACTCTCTTCC
CCTCTTCCCCGTCTAACGGCTCCATCTCGACGAATATCGACTCATCTCTCAGCGGCCAACCCCTCCTGCGTTTACTGTCG
TGGCTGCCCCTCCTAAGATCTCGTCTCATCTTCTCTGCGGCCTGCTTTTTGTTTCTCCATCTCCTTGTTTTCTCTTCTCC
GGGCGCCTGGCATCTCCCCTTGGTATCATCTCCTCCCGTTCGGGACGCCAACGCATTCGAGCAACCCACCCCATCTCTTC
AACCGCTTTGCTTCGTTTCACGCCCTCCCTATCTGCCAGGCTGAATACCCCTCCCCCCGCCCCCCTCCCCTCCTCTCAGT
CCTTATTCTGTTACTGGACCCGGACAACTACAGCCTACATAATAATGCCTTCCTTTCTCTCTGGCAGACAAAGCAGTCGT
CCCCAACAACAACCGCAGCAACAGCAGCAGCAACAACAATCGCCGCCACACGGCTTTGCTGACTCCCTTAATAGTGCTGG
ATCCGATCCTGCCTCTGCTTCTGCTTCTTGTGCGCATCTTCCCCCCCCGTCTCGGCTGTCCCTATCCCTGTGTCCCGTGC
CCTGTGCCCTGTACTCTGTGCCCTGTGCTATGCGTCTGAGCTGACACAGTTGCCTCAGCCTCATCCTTCCAGGCCACAGA
CTTGTTGTCGTTCGCCCACCTCCAGAAACCGCTGCCACAACCGCAGCAAGAATTGCCCCAGCGCTTACATCAAGCCCAAC
CTCAACAGCAACAATTCCGGGCCGCTTCTTTTGTGCCAGGTGGAAACAACCCCGATAAGACTGTTCCTCCTCGAAGCTCG
GCTGCCGCATCTTCGTCACCGGCCTTTGACCCTGTGCAGTCGAACTCAGTTTTGCCGACAAAGTCTACGAACCACGAGTA
CTTGGAGCAAGTGTCGCGCTCGCAGTCGCAGCGCTATCCCCCACAAGCATCGCCTTCCCACGCACACCTGCATTACACCT
CGGCTTCCGTCGGAGCCATCTCCGCAGACGACCTCAGAAACACGCTACAGGGTGTCTCGGCACCCATCGGCCAGACCCCA
TCGAACCTGTTACAGGACCAGTATCTCCAGCAGCAGCCGCAGCAGCAACAAAAGGGCCCGTCGGCATCGCCTGAACCCCG
CCGGACTACCCGCAAGCTTTTTAAGAGTTTTCTTGGCGGTGGCAGTTCGAGCCGTGGATCCGATTCCCGTTCACACGGAG
GCTCTCAACAGCAGCAGCAGCAACAGCAACAGCAACAGCAGTCCGCCCTCGGCCCACCTCCTACATCTCAGCACCATAAC
TTTGGCGGGCTTGTACGCCGCCCCTCCAAGCGGCTCTCCAGCCAGCGGCAGCCGTCCCCTCCTCTCCGCACCGGCCCTTC
GCAGGTATCCATCTTAGACCCGCCGCTAGACGAGTGGTCTGTCCAACAGCAGCAGCAGCAGCAGCAATATAGCGCAGGAG
GACCTAGTGTTGCCAACAGTCAGCCGTCTCCTCTCCAGGGAGTAGGAGAGTTCGTAGCCGGTCCTCCTTCCATACGCCGC
GTCGGCACTGGGGATCTCGAGCAACGAGATACCCAGCTGTACAACCCGGACGATATTGGCCAACTCGACCACCGTCGTGT
TCCGCAAGGGGCCTACACCCCGAACCAAAAGTCGCAGCAAGGCGGTCTGTCGGACGGCACAGTCTATGGTCAAGGCCAAC
TGGAGCAGCAGCAACAACAGCAGCAATACCCCGCTCTTCAGTTCCAGGAACAGACCAGTAATAGTCCCCACCACCCTTTC
GGTGGGCTGCCCAATGCTTCTAATTTCCAGCAGCCCCAATACATTCAGCAGCAAAACGCCGAGACTATCTCACAGCTGTC
GCACGAGTCTCCGATTCCAGACGGTGAACAGGTCCCTTCTTCTGCAGCAGTAAGTTGTTCACCGCAACGACAGCACAGCC
CACAGGATCTAGCGCCAACCCCGCCTCCACTGGCACCGCCTCAGCCGCACTCTGCACAACAATCGGCGTCGCCATTGGCT
CAACAGCGTCAACAGACTCAGGCGCCATCTCCGGGATCGACTCAACAGCAGCAGCAAAAGCAACAAAACATGACACCACC
ATCGGGAGGACCACCGCCTAGCCGCCGATCGCAGGAAGCTGGCGACAGAGGCGGTAATGCTCGTGGGATGCCATCTTCCG
ACACGGCTCCATTGCCGTCAGGCCCACCGCCATCTTATCGGCACAGCCAGATAGGAAGTATCACTCCTGGAACACTGAGT
CCTCTCCCCCCACCTCCACCGGGCGCACCTGGTGCCGGCAGCCAGAGTGCCGATCACCGGCCAGGTACGGGGTCTAGCCA
GCGACAGTACGATGCTACTGGGGGCGAAGGTCGCGGCACATCGAACCCCCCATCCGGCGAACGCGACTCTGCGGCATCGG
AGACCGACAAGGCGCTCAAAGAACTGGGTAAGTGCAGTCACCTGGCCCCTCTCGCGGCTCTTCACTGACGGCCGTGTCTC
CTGTGCAGCACTCAAATACAAGAATGTCAAGCGGCTCTACTTTGAGGGCAAGAGCCAGATCGAGCAGCTGAGCAGCCAGA
TCGAACAGCTGCAAAATGCTCTTGCCAACCAGCGCATGTCCCAGTCGCGTACAGCCCTAGATGATAACGGATACATTGCC
CGGTTCGGCCGTCTCAACGGTGCGATCAACAACCTCTCGTTCAACATCCGCAAAGACTGGGTGTCGCTGCCGAGCTGGAT
TGAGCCGTATGCGAGCGCGGATGCGTTGAAGACAGGCAAGCAGGAGATGACGGCCATCGGGCGAGCGGTGATTTCTCGCT
GGCTGGTGGAGGCGGTGTTCAACTGCTGCTTTCACCCCAATCTGGAGGTCGAGCTGAGTCACCATCTGAAAACGATGGAG
CTGAACATCCGCCGGTCAGCATACAAGACCAGCAGCCAGGAAGAGTTCGGAGCACACGTGGAGAAGGTTATAAACTGGCG
GATGGTCACGCTGGAGGGTCTGCAGTCGATGCTGCAGGGCCACGAACTCAACCAGAACGGCGAGCTGTTTGTGCACAACG
CCACGGAAGCGCTGACGGATTACGTGTGCAAGTATCTGAACGACCCGCCGCCAGCCGGGGTGAAGGGCAGCGCCAGCACG
ATAGTTGACCTGGCGGTGGGGCTTGCGTCGAACATTCCGATGGAGAGCCGCGACGTGGCTATATCATACCCGATGCCTCT
AGACAACATCATCCCCCATCTGATGGATGTCGAGAAGGGGGGCCTTCCGCCACTCGACACACGACCGGCTGATGATGGCG
GGGATCCTGACGACAATGCCAGTGGTGACGACGAGGGCGGGGGGGCGGGCAAGAATAGTAAGCTTCTCTGGTGATGTCGG
TCGGTGCCTGGTCGAACGAGACGCTAACGGTGTACAGCCCACGTATTGGGCGACTTCCCCAAGATTCGGTTTGCCGGCTT
TGTGGCGGTGGAAGTTCGCGGACGACAGGTATTGTCGAAAGCGCCGGTATGGACAATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62