GenePrediction:GLEAN_5787 Details

Name: GLEAN_5787
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:998411..996891 (- strand)
Length: 1521
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:998411..998384 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_173:998315..998127 (- strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_173:997965..997365 (- strand)
Length: 601
Type: CDS
Source: GLEAN
Position: GCSC_173:997289..997156 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_173:997087..996891 (- strand)
Length: 197
>GLEAN_5787 class=GenePrediction position=GCSC_173:998411..996891 (- strand)
ATGGCGCCCACCGAAGAGAAGGAAGCTGGTCAGTCCGCCCGCGTGCACGAAGACGTTGCGCGTCTTACAGCGCGTCAGAC
ACTGACAGCCTTGCAGACTACAGCCTCAACAACCCAGACACGCTGACCAAGTACAAGTCGGCTGCCCAGATCTCCGAGAC
CGTGCTGGCCGCCGTGTCTGAGCTGTGTGTTGCCGGCGCCAAGATCGTCGACATCTGCGAGAAGGGAGACGTGCTGATTG
CCGAGGAGCTTGCTAAGGTCTTTCGCGGAAAGAAGGTCAACAAGGGTGAGTTGGACAGAGTTCACTCGGACAGACACTCT
TTCGGACACTCTTCTCTCACTCCCTCTCTCTCTCCTTTGCTCACCCCCTCTCTCGTCCCCTCCCATCCCCTCTCATCCGC
TCTCTCATACCTCTCCTACCTCTCACACCCTCTCACACTACATTAGGTTTCTCTCACCCGACGACCGTCTCGCCGTCGTC
ATTTGTCACGCCCTACACCCCCCTGCGGACGGACGAGAGCGAGGCCAATGCAGAGCTCGTGGCCGGCGAGGCCGTCAAGA
TCCAGCTCGGCGCCCAGATCGACGGCTTCGGCTCGATCGTCTGCGACACCGTCATCGTGCCCGGCGAGGACAAGACAGCG
CCCGTGACAGGCCGACAGGCCGACCTGATCCTAGCCACGTACTACGCCAACGAGCTGTTGCTGCGGCTGATGCTGCCCGC
CGGCCTGCTGGCTGCCGGCACCGACGAGGAGCGCGTCAAGGCGGCTGCGGCCAAGCCCATCACGCAGACCCGCATGACCG
CCCTGCTCGATCGCGTGGCCAAGGCGTACGACTGCAGCCTGGTCGAGAACACGACCTCCTGGCTCTTCGGCCACGACGAG
ATCGAGGGCAAGAAGAAGATCATCCTGGCGCCCGGCGAGGGTTCCCGTGGCGAGGGCGTGCCCGAGGTCGGCGAGGTCTG
GGGTGTCGAGATCGGCCTCAGCGCCGCCTCCGGCAAGGTCAAGCAGCTCGAACAGCGCGCTACCCTGCATCGCCGCACTG
CCCAGACGTAAGGCCTCAAGCGCCCGACGTCGCGCAAGATCTACTCCGAGGCCCAGCGCAAGTTCGGCATGTTTCCCTTC
AGCCTGCGCCAGCTCGACGACGAGCGTGACGCCAAGTCTGGCGTCGTCGAGTGCGTCCGCGGCGGCGTCTTCCGCCAGTA
TGAGGTTGTCGGTGACAAGGACGGCGCTCCGGTCGGCCGCCTGCTGACCACCATCGGTTCGTCTCTCCTCTTTTTCTTTT
TTTTTTTTTTTTTTTTTCTTTTCCCCCAACGCTAACCACAACAGCCATCACCAAGAACGGCATCACAAAGCTGGGCAGTG
CCCCTGCCCTCGACCTTGAAAAGGTCAAGTCTGACAAGAAGATCACGGACGAGGAGGTCCTTAAGATCCTGGAGCAGCCC
CTGGCAAGGAACACGGGCAACAAGAACAAGAACAAGAAGAAGAAGAAGCCCACCAAGACCGAAGAGGGCGCCAGCGAGTA
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62