GenePrediction:GLEAN_5788 Details

Name: GLEAN_5788
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:993767..987214 (- strand)
Length: 6554
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:993767..991028 (- strand)
Length: 2740
Type: CDS
Source: GLEAN
Position: GCSC_173:990541..989812 (- strand)
Length: 730
Type: CDS
Source: GLEAN
Position: GCSC_173:989450..989357 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_173:988992..988652 (- strand)
Length: 341
Type: CDS
Source: GLEAN
Position: GCSC_173:988598..988158 (- strand)
Length: 441
Type: CDS
Source: GLEAN
Position: GCSC_173:988106..987860 (- strand)
Length: 247
Type: CDS
Source: GLEAN
Position: GCSC_173:987801..987214 (- strand)
Length: 588
>GLEAN_5788 class=GenePrediction position=GCSC_173:993767..987214 (- strand)
ATGCCGCCCAAGGTGGCCGCCAACACGAGAGCGACGCGCTCGCGGTATTCGAGCCCCCAGCAGCCGACTGCTGCAGACGT
GAACGGCAGCGGGAGTGGTGACAGCAGTAGCAGCAGCCATGGGAACAGCAGCGACACGCGGACAAATGGCACGACAAATG
CCCAGCGAGCAATGATGGCACGCTGGCTGGAGCCGCCGGTGCTGAGCAGGTCGAGCTTCGAGGAGGCCGGCTTTCAGCGG
CGCGGTGTGTTTGAGGGCATGGCTCCGCTGGGCACGCTGCCCAAGGCGTCGGCAGTGGCGAAACGGCTCAACGGCATGGC
AGAGGAGAAGAGCTACCAGCAGAACGAGTCTCCCTTAGGCCGGAACAATCAGAAGCAGCAGCAGCAGCAGGGGGAACGGG
TGCGAGAGCGGGAGGAATTGGTTCAGGAACAGGATCAGGAGCAGCAGCTGGAACAGCAGCTACAACAAGAGCGAGACCAG
CCAAAGGAAGCGAAAGAGGAAGAAGAGGAGATGGAGCAGTCGATGGAGCCAGAGCTGGAGCAGCAGAAAAGGCGTACACC
TCAGAGACGCAAGATCATCCTCAAACGGCCATCCAGCGGCAGACACGTCACGACACGTATCGTTGTGGGTCCTTCTGCGG
ATGGGGCGCCCGACGATGGCGAGGACGAGGCGGACGCAGGCGACATGACTGCTGCTGTTGGTGAGAACGACAGCGACAGC
GACAGCGGCCGTCCTGGCTCTGGGGGTCGTGGCCGAGCTGCTGGTGGGCGACGCTCCATCAAGGCAGCAGCAGCAGACCG
CACGATCGATGACAGCGAAGAGGACGCCGGAGATGCCGATTACAAGCCACCGTTGCGAGTTGCGGCAGCTCAAGTGCGGG
CAGAAGAAGACAATAACCAGGGCAGGCAGACGACAAAGCGACCGGTTGGCCGTCCGCGGTCTCGACGGTCCTTGGCAGCA
GCAGCAGCAGCAGCAGCAGTGGACAAGGCTGATGAAGTTGTAGCTATTGCTGCTACAGCTGCTGCTGGCGATAGCGCTGG
CGATAGCGCTAGAGATAGCGCCATTGCAGGCATTGGTGCTAGCGCTAGCGCTGATGGTGCAGGCAGTTCTAGTGCTAGTG
CTGGTGCGCCCGGTGGTAATGGCGCTGTGGCAGCAGCAGTCGGGGCCCTATCTGGCCACATTGGGGCGATGCACGGTCAC
GGCCATGAAAATGATGCCGATGCGGAGGGCAGCGACGATGTGATGGACTCGTACTCGGACGATATGACAGACACCGGGTC
GGAGTCGGACTCAGACTCGGACGGGGCGATCATGTTCAACAGCATGAACCGGCTGGCTCGGTTCGGGCTCAAGCGGCCGC
GGTCGGACAGCAACGCGACAGTGGTGAACAAAGAGGTGACGGACAAGGTGGTGGAGATGGCGGTGGATGAGGCGCTGAGT
CACAGCCGGTATCCGACGGCCTTTGCGCTGCGCACGCTGTACGACGAGCAGTCGTCGAACCAGAGCTTCCTGACGATGGT
GGAGGACGTGTTCCAGCAGACGGCCGATGCGGAGACGCTCAAGACGTTTGCCCGGCTGATCTACGAGCGCAAGAAGGACG
GGCGCAAGGACGATAAGGGCTATTACTACTTTGTGCCGCCGAGCACGGAGAGCCAGTCGACACCGCCTCCACGGTCCAAG
ACGGCGCCGTACGGCCACCTGGTCACGATGCGGCTGCCTGGCGGATCTGGCAGTGACGAGACGCACGCGAGCAAGCGGGT
GAAACTGACGAGCGAGCCGGCCGATCCTTGTCCGTCGGGCGAGCCGGCCTTAATTGTATTTGGCACGTCGTCTGCGCCTG
CTGGCAGCAGCTCTGATCTGCCCGCGCCAGATGGCGCTAGCGACAAAACCAGGCCTAAAACTCCTCAGCCCGAGCTGGCA
AAGATAGCAAAGACACACAAGACTGCCAGGACGCCGCAGACGCAGACGCAGCCGGCGGCGCAGACACAGAAGACGCCCAA
GACGCCCAAGACGCTGCGGACGCCGAGGACGCCGCAGACGGCCAAGACGGCCAAGACGTCGATGTCGGCCAAAGCCGTGA
AGACGCCCCTCAAGTCCAAGGCTGCTGGCGAGACGCCGACGGGCAGAGCTGTTGGTCGGACACCGTTCAGGACGCCCGGC
AACAAGGCGACAGGCAGCACGCGCGGCAGGATGTCTACAGTCAAGGCGGACGCCAGTACGAATGCAAATGGCATCGCCAC
ACCATCGTCCCGACACCGGCTGCGCAACCGATCAGGGTCGATGGTGAGCTCAGCCTCGTCGCTGTCGCCGACAACGTCGC
TGTCGCCGCCCAACCGCACGGTCAGGGAGGACGAGGAGACGATTGACGGCGAAGCCACAGAGGAGGACAAGGGCGGGTTG
GAGCACGAAGCAGGAGGCGGTGACGACGAGAACGGCAAAGACGACAACGATGGAAAGCCAGAGCGCAGGAGCCGACGAGT
CGAGGCGGACCGTCGACGAAGCTCTGCCTTGGTGGCAATAACACCGGCAGAGAGCAGCGACAAGGGCGAAAAGGCCAGCA
CGAGCACAGGTGCCAGTGTCAATGCTGTCAGCAGCAGCAGTAACAGCACAGCCACAGCACCAGCACCAGCACCAGCACCA
GCAGCTGCTGTGGAGGAAAAGCCAAAAGGCAAGGCCGGCGGCAAGAAGGGCAAGGCCAAGCCGGGCACGACACCGACGAC
TGGACCCGGATCAGGCAGAGGTGGACGACGACGTGGAGCCGGGCGACCACCCAAGATCAAGAGAGACGGGACAACAGCTG
CAGCAGCAGCTGCTGCAGCTGCAGCAAAGGGCGCTGTAGCCAAAGGGTCGGCAGCAGCGGCAGCAGCGGCAACAGCGCTA
GCGTCCAGCGGGTCCCCACCCAAAGCAGCAGCCACGCCAGCAGGGTCAGCAGGCCCGACAGGACCAATAACGCCAGCACA
GCGCACAGCGACGACAACGCGAAACCGGTCCAGCAAAAAGGCGATGGATGTGGCGCCGGCTGGATCCGCGTTAATTTCGC
CCACGACCGAAACACAACCCCATACACAGCAGCAACAGCAGCAACAGCAGCACGAGCAGCAACAGCAGCACCGGCACAAG
CACCAGAACCAGCAGAACCAGCAGAACCAGCAGAACCAGCAGAACCAGCAGAACCAGCAGAACCAGCAGAACCATCCCAA
CATCAAGACATCTGCCGCGTCGGGAGCTGCGGCCGCATCGCACGCCATGCCTTCTCTGGTAAGCGACACGGTGTCGGTGC
GGACGGTGTCAGTGGCCAAGCGCGCGGCGCTGCAGCGGAACGGTGGCGATGTGCTGTCGCTGGCGCCGAGCAGCAGCCTC
AAGGCAGCGTCGGGTTTTGTGAGCCGGGCCATGGGTGCCGACGATCTGCGGGATCTGCAGGAGCGGCGAGCGAGTCTGCG
CCGCGAGTCGCGCAACGTGACTAACGGCACGCTGGCCGTCGAGAGCTTTGCGCGTGCGAGTCCGCCGCCGGGCGACGAGA
CCGAGTCTGAGAGCAGGTCTGCGTCCGTGTCGGCATCGGTGTCTGTGGCAGCGTCGACGTCAATGTCCGACGCCGGCTTC
GTGCTGCAGACGCCGCAGCCCAAGGGCCATGGTCAAGGCCAAGGCCAGGCCCAACGACAACTGCGCGCCTCCACGACGAC
AGCCCGGGCGACTCGCTCGGCGCGCAAGCGGACGTTTGACGAGGTCGACGACAACGACAACGAGAACGAGAACGACGTCT
CGCCGTCCAGGGCCGCCTCCTTTGCGGCCGACGAGCCGCCACCACCGCCACCGCCATCGTCATCGCGTCTGCAGACGCCC
GTGCCCGGCCAGCAGTCGGCTGCCTCTCTCACCGGCGCGTCTGCGCTCGACTCGCGTGGCGGCACGCCCGGACCAAAGCC
CAAGAGGCCACGCATCGGTCCTCGGGTCAAGACTTCGTAAGTTGTCTTCATTTTCATCGTCGACGTGACGCCAAGGTGAC
GACAAGGTCGGATGACGGGTCAGACGAGACGAAAAGACGAGGAAGCGAGGGCGGAAAACGGAAATGGAAAACGGAAAACG
GAAAACGGAAAAATCGGAAACTAGGACACGGTGAAGCTCTTGCTCCTATTGTTGTCAAATCCCGCTCTTCCTCCGTTTGG
GCCCAGCGACCGTGCTCGGCTCCCTCTTGTCGTCCTCGTCGTTACCGTCATCGCCTTCATCGTCTTCGTCCTCTTTATCG
CACTCTCCCCTCAACATCACCATGAAGGTACGCCGAAACGCGACGCAGATGCAGGTCTCGCTAACTACAGAATGCAGGCC
GATGAAGCGCAAGACGGGCACGTCAGCAGGAATGCCTCGACCGAGCGGAGAGCGCGCAAGTCCTTCGGCAAATGGCCCTG
TGAACAGTCTGGTAAGAAGCATCTACGATCTAGCCCGTCATTTCTGTCTATCTGTCTATCTGTCTATCTGTCTATCTGTC
TATCTGTCTTTTGTCTTTTTGTCGCTCTTGCCCTTTTCGCGATCCCTCGCCTTTCTGCCCTGCTGCTCCTTCCCTCCTAC
GGTCTGCATGCCAACGCGTCTGTTGTTTTAAAGCCCCATTCACTGATTGGAGCCCTGGCTGGGCCCCACTGTTTGAGCTT
GTGGCTGGAGCTCGCTTTGACCTAAAGCGTCTTCTCGCTCTCTTCTTTCCTTTTTGCCGATCTTTATCTCGTCTTGCCTG
TCTTTCATTCTCTTCACGGCCACTTCTGCCGGCCGGAGCTAACAGCCGACAGCAGGACGAGAACGACGACTACTGTGCCT
CATGCGGCGGCAGCGGTGAGCTGGTCTGCTGTGACGGCTGCACGCGGTCGTTCCACTTCAACTGTGTCGACCCGCCGCTG
CAGGAGGGTAGCAATCTTCCGGATGAATGGTTCTGCAACGTATGCGCGAGCAAACGGAACCCGGCCGCCCTGGGCCACCA
CCAGGGTGTGCTGGGCCCGCTGCTCAACCTGATCGAGAAGCAGAACTCGAGCGCGTTCAGTCTTCCGGACCACGTCCGTG
ACCGCTTTGAAGGCGTCAAGACCGGAGCTGAGGGCGAGTACGAGGACATTGTGGCGCCAGGGACGAATCGGGCGAGGTAT
GTTTGTCTTCCTTCTCGCTTTCTTGGCTTCCTCTCTCTAACAAGCCCAGGAAACGGGGCTACGAGGAGACGCCGGACTTT
TTCCGCATTCGCGATGCCGAAGGCCGTGCCGTTCTCTGCCACAGCTGCGATGGCTTCGCTAAGGAGGACCGGCCCATCAT
CCCATGCGCCTTCTGCAGCTTGTGGTGGCACATTGACTGTTTGGATCCGCCGTTGGCAAACCCGCCGGTCTTGCGCAACT
GGCGATGTCCCGCCCACGTGGATGATCTCTTGGCCAAGCTGCCGGGGCTGTTGGGACCGGCCCATCGGTTCCGTAAGATC
AAGGACGCCGCCGTCATCAAGACCTCCTACTCGCGCGGCCTGGCCAATAATGGGTTCATCGAGCTCAACTCGGACGACGA
GTCCGACAGCAACTTTGCGTCTGGTGTCTGCACCTTTGGCCGCGTCCATCGGATCAGTGCCAAGGGTGTGAAGCTAGACT
TTTTGGAACAGTACGTGATGATTCTATTACTTCTTCTCCTCCGTATTTAACATCGGTCCAGGACTCGAAAGGAACGCAAG
GGGCAACTCCGACACGCACGAATCAACCGGCGAATGCGGCATCTGGCTGCTGATGCCACTGAGCATCGCGATCCTTCTGC
AGGTCTGGCCCTGACAGCACCATCTTCCACCTTCCTTGCAGATCGTCGCAGCATCGACGAAGCTCAGGCTATCCACAACC
TCTCAGCGCTGACGGCCGGCTCCGACATTCAAGTCGACCGCAGCGGCGAGCTGATCAACGCTCTTTTGGTGAGTCGATTT
GGCATTCCTTCCAGCTATGTCCCCCCTCAAGCTGACCATCTTGCAGGCACAGGCAGATCCGACAGCCATCGCGATGATGG
CCCAAGGAAGCGCTCTCAACATCGAGACTGGCTCAACACTGAGCCAAGGCGACCGGACAGCTCTTGCAGCCATGCGTGCG
AGGATAGACAGGCTTCTCGGCCTGGACGTGGAAGCGCCGGAAATCGTCATGGCCGATGCGTCTGCTGGACGAAATGAGCC
CATGACAGCCGGCGTCGGTACCAGCAACAGCGACTACGAGCAGCAGCTGCGCGAAAGCGACGAGGCTGCGTCCAAGAGCA
GCCCGGATCAGATCCAAGAGGTCATGAGCCTCGTGTCCGATAATGGAGACAGCGATCTGGGCGAAGAGGATCCCCTGCCG
ATTGCCACGCCGTTGACGACGGTGCACGAAGAGTCGGCAGCAGCAGCGGCGGTGTGGCCAGGCGAACATCACAGCAGCGA
CTCGGTCGGCCGTCTGTCTACGGGCACCGACCAGGAGAAGAGCCCGATGCATGCGGCAGCAGCCATGGCCACGGCTCTGA
CACCGTCCCTGGGGCCCTTGAAACCGGCTGCGAAGCCGGACGAGATTGGCAGCAACGGAGCCAAGACTGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62