GenePrediction:GLEAN_5789 Details

Name: GLEAN_5789
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:974476..970845 (- strand)
Length: 3632
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:974476..974449 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_173:974205..972931 (- strand)
Length: 1275
Type: CDS
Source: GLEAN
Position: GCSC_173:972874..972801 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_173:972745..970982 (- strand)
Length: 1764
Type: CDS
Source: GLEAN
Position: GCSC_173:970907..970845 (- strand)
Length: 63
>GLEAN_5789 class=GenePrediction position=GCSC_173:974476..970845 (- strand)
ATGACCAGACCCGAGATTATTCGCGCCGGTAAGTACGGAGTGCATTCCTTACTTTTAAGCGTATGGGGCCATTACCCTGC
TCCCTTCACGTTTTCCTACAAGTACTTGTCCTTACGTCGTGCTCCCTGCTGGAATTTTACCCGCTGTTGTTTTGTTCTGC
GCCCCCTGTGGCTGGGATGGAGAACTAGACACGGGCAGACATTCCTTTCTTTCGTGGCGCCAGCTTGCTAACCTCTGTTT
CATCCTTGCCCGTGCACTTAACGCGGTTCAGACTCTATTGACCTTCAGGATCCTGATGCGCCTTCTGCCGAGGACCATTC
GCGACTGAGAGCCCCGACTGCGCAGAAGACTGCTTCCTCCTCCCCATCTTCGTCATCCTCCTCCGTGTCGTCTCGATCGC
CTGTAGGCTCGCTATACAACAACCACATCTCTCCGCACCAGGCCGAAACACTTTGCGAAATCGCCGCAAAAACAGCAGAG
GAAAGACGCATATCGTGGAACGGCGCCGATTTCAACGACGCCCATCTATATATCCCTGACTCATACACTGGCATCGCGGA
GTCTCGCAACCCGGTGCACTTGCGGTCTAGCCCAGGCGGCGTACAGCAGATCAACATGGCCGCTGCCAGCGAGCAAGATG
ACCTGGCTGTCACCCAGAACGGCGGCTCTTCCAGCGCAGATGTCGAAGAAGACGTCGACGATGGCGATGAGGGCTTGGAC
GATGACGATGACGATGATGACGACGACGACATGGACAAGATCTCCAGCTCGCCGTCCATAGAAGATGGTGGGTACACCTG
GAGCACTTTGCTCTCTATTTCCTTACCTCCTATTGCACCCCTGAATGTCCACGATTCTGTGCCCCTCCTGGGTGCCTTAC
CGACGACACCTGGCAACAGTCTGCTAGTTGCGAGTTGCCCAGCGATTACGACGTCAACAGAGATTTCCAGGACCTGGCTG
GTAGTACCGGCGCACGAGAGCAACGCCCCTTTTCATGCTTTACGGGGCCTGCAGGCATGCAAGGCATCTGCTGCTTCTCC
TTGTTGTAGACCGCATGGCCATCAGCTTGTCGCAAACATCTCGATGTTCCAGAAGGAACAGCAGCACAGGGGCTCAAACG
ATGCTGTGGCTGTTCACAGCTGTGGAACATTACTGGAGCCCGATGCAGGCGACTTCTGCAGGTCCATGACAATCGGCATA
AGAACAGGACAATGTGGGGACGAATGCCAAGTGGATGGGCTGGATGCGAACTATGCCGACGCCAGCGACACCGTGTTGCG
GATTCCCTATGACTGTAGTGACAGTGATGACGATGATGATGATGCTTTATTTTCCAGTTGTGAAACAAGATTTGTGGAGT
CTGGATGGGACAGCGCGTGCTTACACAATACAGAGGATATCGACTTCGAGTTCGTTTACGCACTGCACACGTTTGTGGCC
ACGGTCGAAGGCCAAGCAAATGCGACAAAGGGCGACACAATGGTCCTGCTGGACGACAGCAACAGCTACTGGTGGCTGGT
GCGGGTAGTGAAAGACAGCAGCATCGGTGAGCTCGTCGCCTATCTTGCCAACCGAATCTTTAGCTACTTACCTTTCTGCC
AGGCTACCTTCCTGCTGAGCATATCGAAACACCGACCGAAAGACTTGCCAGACTTAACAAGCATAGAAATATCGATGTGC
GTCAGAAGACGGCGTAATTCGATGCAGGATACCGTACTGACCGGATTTTAGTTGTCAGCAACAATGCTTGGTGACCAGGC
AGAAAAGGTCAAGAACCCCATACGAACGGCTATGCGGAGACGGAAGGCGAAGAATGTCACTTTCGCAGCACCCACGTATG
TCGATTACTCTGAGATCGAGTACTCTACCGACGAGGACGACTTGGAAGCCGAGTACTTTTCGCAAAAGCAGCAGGTACAG
CAGCACCAAGGAGACGGCGACCAGAAGCAAGACCAGAAGCACGATACGGCCCTGCAAGCGACAGACGACGATGAAGATGA
CGACACGGCAAAGGTGGAGCCCCTCAAACCCCGGGCACCGAAAGAGAATGGCGCGGGCGCTGATGCAAGACAGGAGGACG
CCAACGGCGATGCAAATGGTGGCAAGGGCTTAACCAGAACTAGCGAGGAGATTTTTGTGGCGTCGAAATCCGAGACGCCA
GGACCTACGAAAACAAAAGACGGCACTGTCCGGGACTCCTTCTTCAAGGACGACACTGTGGAGACGAAGAAGATCACCCT
GACGCCAAACCTGCTGAGAGATGATAGTGCGCCGCGGACATCGTCCGAATCTAAGGAGGCGAAGGCGCGGGTAAGCCTCG
ACCGTCTCGAAAGGGACATTAACAGCGTGCTGGTCAAGGACGATAAGAAGAAGAAGGATAAGAAGGAGAAGGACAAGAAA
CCAGGTGCCTTCCGAAGCCTGTTCTCGCGGAAAGACAAGAAGCGGAACGAGTATGAAGAAGACGACAGTTCGGGTAAACG
GTCGATGGACACTGCCAGTATAGAAAAGGACGACGAGACCGATGAGCAGTCGAGTCCCGGCTCGACAGCCAGCCCGCAGA
GGCAGCCGAGTAAGCTACAGAAGGCAAATCCCATGGGTCAGGCGGCAGAGACTTCACCAACAAGAAGGCCATCTGAGAAC
AGCTCTGGACACAGGGAGATTGGTAGGGCAGCTGATCCGTCCATTGGTTCTTTTGATGTAGCACCGGGCGCCAGGCCGAA
CAATGCTGACCACGTTCCTCCAGCTACCATGCGTCTCATCGAGCCGGAGCACGATCGAGAGATCAGCCAAGAAAGCATAT
CGAGTGTGCGGCCTCCTGCCAGCGCGCCGTCCAAGGTGACGGCATCAACTACGGCCATAAAAGCTGAAGATGGCCGACCG
CCGATGGTGACAATGGCCAGCTCGCGCGCAGCGTTGGACGATTTCGACTCGGACGAAGATGATGTGTCTGCGCCGGTGTC
CCAGCAACAAGGACCAGTGCCTGAAGAGACGACTAGGCAACAACAGCAACAACAGCAGCAACAGCAACAACAGCCACAAA
AACAGGCTATTAGCGCTGCTGCCACCAACAGCAGCTCGGAAGTAGAAAGGGCGAGCAACCGTTCGGCAATGCAGCTGGAG
CGGCTGTCGGAGTCTCCAGTACAGGTGTCGCCAATGCATTCCAACAACCCGCCGCCGCTGATGGTGGATACGTCGAGCCA
AGACGACCGGTCGTCGCCGATCTCCTCGCCATCGCCAGAGCTCATTGAGGCCGAGGACGGTTCGGCTACCCATCACGCCC
AGGACTCCATTGCGACGTCAACATCGGCCACTACGGCCAACACGGCGACGTGGAACGACGAAAACCTCAGGGCATTCTTC
GACTCGGGCACCGATATTCGCGACCTCCTTGTCGTCGTGTACGACAAGACCGATGTTGCACCAGCCGGGTCCGACCATCC
TGTGGTCGGCTCACTTTTCAGGGAGCAGACGGCCAAGCTGGCTGAGATAACAACTGTGAGTTCTTCCGCGGTGTCGTTTA
CTGTGCATATCTTGTTGTCTTGGGATTGTCTTGCTGATAAGCGAACTAGCAACTGGACAATATGCTGGGCGACTGGCTTG
CTCGGAAGCAAAGACTCCGGGGTAGTGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62