GenePrediction:GLEAN_5792 Details

Name: GLEAN_5792
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:947775..947133 (- strand)
Length: 643
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:947775..947746 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_173:947674..947303 (- strand)
Length: 372
Type: CDS
Source: GLEAN
Position: GCSC_173:947249..947133 (- strand)
Length: 117
>GLEAN_5792 class=GenePrediction position=GCSC_173:947775..947133 (- strand)
ATGAAGGCCTACCTGTACGACAACTTGCCAGTACGTTTAGAGGAAGGGTGAGATATGAATTATGGAGGCCATCAGCACTC
TCTGCTAACACTGCACTCCAGGGCGATCAGCGCCTACCACATGACTCGGGTAAGGCTGTCGATGCCGAAGCCCTCGAGCG
TCTCGGCGTGATCTATCACCGCGTTCCAGATATTGCGGCTGTTGACCAGCTCGCAGCCGAGCGGGGCTACAAAAACCGCG
ACGAGATTAAAATCTCGCCCCAGTCGCTCGGTGACGCCTACGATACCAAGGTAAAGAGCTTCTTTAACGAGCATCTGCAC
GAGGACGAGGAGATCCGCTATATTCGCGATGGATACGGCTACTTTGACGTGCGTAACAAAGGCGACGCGTGGGTGCGCAT
CCAGCTCGAGAAGGACGACCTGATCATCTTGCCGCCTGGCATCTACCATCGCTTCACTACCGACGATACGAACGTGAGTC
CACCGGTATCTCCCGTGCTTCTCCTGCGCTCACTAACCCTTTGTAGTTCACGCATGCCATGCGGCTCTTCAAAGACGAGC
CCAAGTGGACACCACTTAACCGCAGCAGTGAGGTCGATGAGAACGAGCAGCGCAAGAGCTATGCCTCCCAGTACCTTAAC
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62