GenePrediction:GLEAN_5793 Details

Name: GLEAN_5793
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:943997..943412 (- strand)
Length: 586
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:943997..943889 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_173:943832..943708 (- strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_173:943633..943412 (- strand)
Length: 222
>GLEAN_5793 class=GenePrediction position=GCSC_173:943997..943412 (- strand)
ATGGCTCCGAGAAGAACATCCGGTGGTGGTGCGGCAATGAAACAGAGCACCCGCGCTCCCCGGCCTTCCAACGCTGGCAG
GAGAAAGTCTCGACCAGGAGATGTTCAGCGTACGTCTCTTGCCACTGTATGGTTTCGCGTTCTTACGCTAACATGCATTG
TCCAGCCGGCGACCCGATACCCCAAAGAAAGGCCCGTCGGTACCGGCCTGGCACTGTTGCGCTGAAGGAAATCCGACGGT
ATCAAAGTAGCACAGAGCTTCTGTTGCTCAAACTGCCTTTCGCCCGACTTGTAAGTCCCCTCTTCCGACGTCCTGCAGTG
GACAACACAGTCGCGCAAGTTCGCTCCATACTAATAGCCCACAGGTTCGCGAAATTGCCCTTACCATGCGACCACACGAC
GACGGGATGCGGTGGCAGTCGCAAGCCATACTAGCGCTGCAAGAGGCGGCCGAAGCTTTTCTCGTCCACCTGTTTGAGGA
TACGAATCTGTGCGCCCTGCATGCACGGAGAGTTACTATTATGCGGAGGGATATTTGGCTGGCGCGGAGAATACGCGGCC
TCTGGGGTGGTGGTGGCCGGTATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62