GenePrediction:GLEAN_5794 Details

Name: GLEAN_5794
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:921382..920849 (- strand)
Length: 534
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:921382..921108 (- strand)
Length: 275
Type: CDS
Source: GLEAN
Position: GCSC_173:921052..920964 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_173:920895..920849 (- strand)
Length: 47
>GLEAN_5794 class=GenePrediction position=GCSC_173:921382..920849 (- strand)
ATGTCTTTCTTCATGCGCCGGGCCGCCCTGTGTGCCGCCCCTGTTGCCCGCTCGTTCAGCACGACGCCTGCTCGCCGGGT
TGCCCGCATCACCATTGTCGGCCACCTGGGCGACACGCCGGAGCTGCAGACGACGAACAGCGGCTCCGAGATGCTTAGAT
ATGTGGTGGCCAGCAGCAGCGGCCCGCGCGACAACCGCCAGACCAGCTGGTTCCGCGTGGCGAGCTTCCTGCCCGAGGGC
CCGCAGCGGGATCTTCTCCGAAGTCTGCCCAAGGGGTGAGTTTGACCGAACAGAGAAGGGTGAACTGGACGCATTGGCTT
ACCCGGACAGAACACTCGTCTACGTCGAGGGAGACGCCACCATGAACACGTACTCGGACGCCGACGGCAAGTCCAAGACC
CAGCTGAGCATCCTGCAGCGTACGTCCCGTCGACTTCTTCCTCTTCCATGCTCCTTTTCCCTCTTACTGACGGATCTGCG
CGTGCAGGCAGCATCGAGGTGCTGAAGCGTCCGACCCCGACGGAGTCGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62