GenePrediction:GLEAN_5795 Details

Name: GLEAN_5795
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:915015..911822 (- strand)
Length: 3194
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:915015..913789 (- strand)
Length: 1227
Type: CDS
Source: GLEAN
Position: GCSC_173:913471..911822 (- strand)
Length: 1650
>GLEAN_5795 class=GenePrediction position=GCSC_173:915015..911822 (- strand)
ATGTCAGCCGTGATAGCGGCCCTCGGCGCCGTCATCGGCTATCTCGGCGGTGATGTGGCACAGAAGAGCACCTTTGAGCG
GCTCCTGTGGCCGCAGCGGTTCCACAACCACCTCGACGTGGCCACCGGCGTCAAGCTGGCATTGCTGCACCCAATGAGTG
GCCCACTGCAGTCGGCAGCCCTGGCGACGCTCGACGACTTCCGCGACAACGGGCTCTACCGCGGCTTCTTGCGCGGCGAC
ATGCTGGGCACCGCCTTTTACGGCGAGCACCGGGACGTGCGCTACTTCCACCGCACGGCGGCCACACCAGAGCAGCAGCG
GACTGCCGACAGCGTCCGCAACGGCTTCTGGTACCAGGTGCTAAAGGAGGTGGAGCGACGACATGTCCTCCGGCCGGTGG
CTTCGGGCGGCAGCGGTGACGACGTGGAAAAGACCGCGGCAGAGACCACGACCGATATCACAGTGCCCAGCCGGTCCGTG
AAGCTTCTCTTTCGCCTCAGGCTCAGCGTCCTCGACAACGAACCCGCGCCGCCGGGCGCCAACGACGTCGTCGAGACGGA
CTTGACAAAATGGACTTTCCTGAGCATCGTCACCAGCGAGCTGTCAACCATCTGCGTAGCCGTCGCGACGGGCCTCTGGG
CATTCCTTGGCAGGAATGCGTCCAACGGACCCGACGCCTGGCTGGTCGGCTATTTCCTGCTGCCCGTCGTCCTCCGGCTG
CTCGCCGCCATCTCCTCTGTCAGGCGCGAGGACGTATTTGCCGGCGGCGAGGCCATTCCAACGCTCTGGACAGAAAGGAC
TGATCCACAGTACAAGGAGGTCTTTGAGATCTACGACTCGGCGGTCGGATTCATACTTGGCTTGTCCGCCCCCCCGGCAA
CAACGGCCATGACCCAGTTCTTTGTGCACTACGGTCACCCTATACGACACACCGTCATAGACAGAGTCCGTGAGACTCTC
AGCATCGCCATCGTCTACATCTTTGTGCTCTACTTTCCCGTCGGCCTCTTTGCCCTGTCCTGGATGAAGACGAGGTCGCA
GTACATCTGGTTGGGACAGCAATTTTACTGCATTCTGGCCATGCACATTCTGCGCATTCTCGGCTGGGAGGGCTGCTCGA
GGACGGAGGAAAAGGTTGCCAAGATACTGTACAAGGATCGCTGCGCGTGTCTCAAGGGAAGGAATGCCCGCGTGGAAGCT
AGGCTGACGATAGACCACGTTCTGTCTGTTCGTGCAGGAAGAGAGGAGGTGAAGCAAATGCTGGACAGGAACATGGGCTT
TGCAGCGGCGCACTAAATCCGATAAGAGATGACATGTCGTCGGCCCTGTAACGTCTTAATACTGGACTGCTAGCATGCTT
AGCCCAACACAAATAGATGCCCGATGAGACCTCAGCCTTGTCCTCCTCATCGCACTTGGCTAACCGAGTTGTGTCTCTTC
AGATCTATGCTTTCTGTATGCTGAGAGGTAATCTGAGAAAATGGTATTCAGATTCCCACAGCAGGCCTTGAATGCTCGCC
ATCGTTGCTAATCTCCACTGCTAGTCACCTCATACGTTTAAGCTGGCCGACGACTACTGGCCGCTCCGACTGCTCCACAT
CCCAACCAGGACATCAGTACGGCGGCACTCGGCCCACGACTATCGCGACCCTACGGGTAAGGTGCATCAGCGGCCTCAAT
ATAGCATTCTCTCATATACCTGGGGCCGCTTTAAGGTGGACGGGGGGGAGACGCTCGCCGTAGAAGGAGTGGACTGGCAG
ATTCCAGCCATCAATCCAGAGCACTTTACGGCCGCAGCGTTCCAGAGGGTGATCGACGAGCGTCTCGGCAGTGATGCCAT
CGAGTGGGCGTGGATCGACGTTGCCTGCATCGATCAGCGCCCCGGCAACCCCGACATGGCCATCGAGATCGGCAACCAGG
CGAGCATCTTCAACAAGGCGGCCCACGCTTTTGTCTGGCTGACGAGCATCGTCGGAGGTAGAGAGACAGCCATCAAGGAT
ATTGTCAGCTTTGGCGTGGAGCTGCGCAACTTCATCGACCACGGCAAGACCGACAATGGCCTCAGCCTCTTAGATGTGGT
AGCACGCCTGCGGACGGCCTTCGATACCGTCTTTGAAGACCCGTGGTTCTCGTCGCTGTGGACGCTGCAGGAGATCGTAA
TGCGCAAAGACGCCATGGCGATCTCGTTGGCGGCCGAGAAATTGACCTGGGATGGCACGGACGCTATGCACTTCTTTATG
TTCGTCAACACGGCCCAAAACGTGTGGCAGGATGTGCTGGCCCTCATCGACCGCGCCGGAAGGCTGCGATATGCCGACGC
GTACGCATACAAGCCCAGTTCACCCGTCCATGAACACGTCTCGCGGATTCAGCAGTGGCTGCTCTCGACCGGATTCTACT
ATCTGGACACCGACAACCCCAACGTCCAGTACGGCACGGCCAAATACCGCAATACGGAACACGACGAGGACCGGATCTAC
GCCATCATGCAGCTTTACAGCCTCCGGGTGGGAAAGGCAGCCCAGCCGGATCTCGCCCCGGAACTCTATCCCGGCTTTGC
CCAGCTCGAGCTTGAGTTCGCAGACGCTATCAACCAGTGCTGTCCCATGCTCGGACAGATGTTCACGCACACCGCATGTG
ATGTACCGCGGCACACGTGGTGCATCACGCGAGACTCGACTGTGCCCGACAGCCTAATGGACTACCGAGATCCTAGGCCG
CTCGGCCGCATCTCGCTCGTAGAATCGGGCACCGCTGTCGCGCACGGCAGGTGTTGCCTACTGGCGGACCTGAACGAGCT
CCTGACAAGTCCTGGACGTCGGGATCTCTCGTCCACCAGCGCACAGCTGCATCTGGATGAATACATGCGCAAGGCCCTCG
ATCCGTCACCGGCGCTCGCCTGGCACATCCGCTGGGATAATACGGTGCTCATGCCCAAACTACTCAGACGTTATGGCCGA
GAGAACCTGGTACTCCTCCATCTGGGAAGTCTCAGGTGGCCGGAGTGCGGAAAGGAGGAGCGACGTCGGCAAGTGGCGCT
GCTCCTCAGTCCTGTCCACCCGACTACGCCGAACGCTGTCATCGGAAAGACGTACTTTCGATACGGCCTGTATACGTGGA
TCGAGTATACCACATCGATGACAGACCAAGTCAGCCGGCTTGCATGGGAGACGATGAGTCTGCCCGTCACCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62