GenePrediction:GLEAN_5798 Details

Name: GLEAN_5798
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:898970..893389 (- strand)
Length: 5582
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:898970..898870 (- strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_173:898802..897693 (- strand)
Length: 1110
Type: CDS
Source: GLEAN
Position: GCSC_173:897640..897369 (- strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_173:897318..896466 (- strand)
Length: 853
Type: CDS
Source: GLEAN
Position: GCSC_173:896271..895093 (- strand)
Length: 1179
Type: CDS
Source: GLEAN
Position: GCSC_173:895026..894396 (- strand)
Length: 631
Type: CDS
Source: GLEAN
Position: GCSC_173:894042..893389 (- strand)
Length: 654
>GLEAN_5798 class=GenePrediction position=GCSC_173:898970..893389 (- strand)
ATGCTCGCACCCAACAAGCCCAAGGGCCCGAGGGCCTGCCTCACGTGCGCCAAGGCGAAGAGCCGCTGTGTGCCCGGCCC
CGTTGCCAACGTCTGTGAGAGGTGAGTTTTCTCTGGGCTGGCGGCTGGCTTGGCCCGCCTGACCATCTGTTGTCGTGTTC
AACCGCAGATGTCAGCGTCTCGGAAAGCCGTGCGGATCGCAGACGCCGGCACCACAACGCCGTCGACGGCTGGAAGGATC
GACTGGCGGCACCGATGCTGCCACTGCTGCTACTGTCTCTTCTGCTGTAGGGGTCGCGTCGACCGTGGCCCAACGCCCGA
GAACGACCAAGCCAACTCGGGTGTCGGAGCTCGAACGTCGTCTTGAAGTCCTCACCAGCCGACTCGAGACGGTGGGCCGA
CAGCAGAAGCAGCAACAGCAGCCGACGACGGCAACTTCACCGCAGGACGACGCTGGACAAGGGGACGAATCGGCAGCAGC
AGCAGCAGCAGCCCTTTCGACCTCCCACTTTGTCAAGAACCAGCCGATGCCATACTACCCTATGACCCACATCTTTGAAC
CCAGCAGACAGACTACGACAGCGGCAGCCGATGCAACGACAGCCGAAGCCGAAGCCTCGTCGCCGTCTGTGAGCAGCAAC
AACAACCAGAGCGGCAGCGTGTCGGGCCTGTCGTCGTCGACGGCGGTATCGGCGCCCGACCTGGACACAGACGACCTGCG
GCCATGCCACTTTTTCCCGCCGTGCCAACTGCGACAGCCGCACACACCGCCGACAGGTGCGACCGACACGGCCGACGCAG
CCGGCGACGTTTGGCCACAGGCCGAGGAGGCCGAGATGCTGCTGCAGGAATTCCGGTCGCACCTGATGCCGCTACTGCCG
TTTGTAGTGGTACCGGACGGCGTGTCGTCAGGCCAGCTGCTGGCGGCACAGCCGCTCACGTGGCGAGGCGTGATGATGAC
GGCCTGCCATCTGGACGGCCCACGGCAGATGCTGATGGGCAACCAGCTGCTGGGCGAGGCGACGGGCGCGGCGCTGCTAC
AGCCGCGGCGGTCGGTCGACGTGCTGCAGGCGCTCCTTCTGCTCCTGTCATGGTTCCACTACAACATCAACAGCTTCCAG
CTGAACAACCTGCTCTTTCTGGCACGCGGCATCACAGTGTCGCTCGGCCTCGGCGAGCCGCATCCGCCGAGCAGCAGCCC
AGACGTGCCAGACGGATACACGTCCGAGGTGCTGCAGAAGATGCGCTGCTTTTCCGGGACGTTTTATCTGGCAACAGTGT
GAGTGATGGTGGCTGTCGGGAAGGTCTGAATAGCTATTAACCGGTTGCAGCGCGACTACCAACAAAAAGGCTGACACGAT
GATGAACTCGCCGTACCTAGACACGTGCTGCCAAGTGCTCGAGCGACGGATGGAACAGCCTTCGGACAGATTTCTGGTGC
AGCTGGTGCGGATCCAGCAACTGAGCCAGGCGATTGTGGTGGCGTTTTCGCTGCGCAATGCCGGGATCCAGATGGATCTG
TCGACCAGCTTCATGGTGGAGAACTTGAGCCAGCGGATTGCGCAGTACAAGGCGCAGCTGCCGGTGCACTTCCGCAACGA
CGGTGAGTCTGGCTGTATGCGTGTTTCCTAGCCACGGATGCTGACAAGCCAGTGTCGATCAACTGCCACATGCATCTGGC
TGAGGTGTTGCTGTACGAGGTCGGGCTGCAGGATAGCAACGGGCTGAACAATGGGCTAAGCCTGCCGGTGGCGGAGCGGC
TGAATCTGCTGTCGGCCTGTATGCGGGCAACACGCGACTACATGCAGAGCCGGTTTGCAGAGCCGGTGCAGGACCAGCCA
CGCTTTGTGTGCCTGACGGCGTTTGACTTTATTTATGCCTTCCTGACGGCGCTCAAGCTGATGACGTTCCAGATGCCGGG
ATGGGATCCACGGCTGGCGCGTGAAGAGCTGGCCTTTGACTATGTCGTGAGCCGGCAGATTTTTGACATGCAGCAGCTGG
CACGGCGACGGGGCATGCGCAGCCACAAGGCCAGAGGCAGTGAAGCCGGTGCGGCAGCCGGTCGAAAAGCCGGATCTAGC
GAACGTCGGGATCCGTTCCAGCGGCTGGCGACGCGACTAGTCGAGCTCAAGGCGATGATATCGCGGGAGCTAGACCAGCT
GCCCAGCAAGTCGACCGGAGAAGTGGCGATGTCGGCAAATGAAGAAATGCTGTCAGCAGTAGCAGAGGCAGCAAAAGCAC
CCACACCCACACCCGCACCTGCACCTGTACCCGTTGCAGAGAGCACCAACGCAGCCATGGCAGACGCAGAGCTGATGACA
GACTTGGCGGGTGACTTTGACATTGGCATGATCGACGCGGCGCCGGCCATCTTCAGCTTTGCAGACGCAACGATGGACTA
CATGCAGAATATGGACGGATCGTCGTGGCCGGACCTGTTCAACACACCGGGGCTGGACTCGTACATGGACGTCAACCTGG
GGACGCCGCCGTTTGATTGGGACATGTGAGGAGGAGGAATGATCCGTATGAGCTCGTTATGTATTGTGAATGGAGTACTT
TTGGTAAATCGAATGGAGGACAGATTGTCGATAGGAAAATGGTACAAGAGAAGGCGCCGTGTGCCGAATGCGGCAGGGAC
GAGCGACCCACGTTTGCGCGAGATTTAACGCCGTGGTGACGTTTTCGCGCTACTTGCAGAACTCCTCTTTTGAAGAAGCA
TACGATTACCCCATCATCATCACCGCCATTCAGCATCATGGCAGTCCAGGTGCGGCCGGTGGTGGACTACTCGGTGTACC
TGGTGACAGACGGGACGGCAGCGATTCTGGGCGACGGCCGGACGGTCGAGGGGGTCGTGCAGGCGGCTCTGACGAGTCGG
CAGGCGAGCGAGGGTTCTCAGAGCCGCGAGAGTTCCCGGAGCAGTGTGGGCATCGTGCAGCTGCGAGACAAGCAGTCGGA
CGCGCGGGGTCTGTTAGCTTCGCTGGCGGCACTGCACGAGCACACAGCGGCGGCCGTCGTGCCGCTGGTGATCAACGACC
GGGTCGACGTGGCCGCCGCAGCGATGACGGGTGGATTCTGTGAGGGCGTGCATCTAGGCCAAGACGACGTCGACGTGGCG
ACAGCACGACGGCTGCTGGGGCCGGCCGCGCTGATCGGCGTCACGGCAAGCACGGCAGCCGAGGCCGTGGCCGCCTGTCG
TGACGGCGCCGACTATCTCGGACTCGGCACCGTCTTTGCCACGGCCACCAAGACCGATACCAAACACGTCGTCGGCACGG
CTGGCCTCCGTCGCATGCTGGCTGCCATTGCCCGTGCTGGCTTTGGTCACGTGCCGGCCGTCTGCATCGGCGGCATCGGG
GCTGCCAACGCCCGCCGCGTCGTCTTCCAGGGAGCCTGGGAGGGCGACGACGTCCAACAGCTACCCCCGAAACGAGTCGA
TGGCATCGCCGTCGTCAGCGCCATCATGTCGGCCCCCGACCCGGCTGCTGCCGCCGACCAGCTCGCCCGTCAGGTCCGTC
TCGGCCAGACCTGCGGGCCCACGGCTTTCTGGGCAGCTCCGACGACAACCACAACAAGAAGCAAAACGACCACCCGCTCC
ATCCAGCCCATCCTCGCCGCCATGCACCGCCTCACGCCCCTCTCCCACAACATGACTAACCTGGTGGTGCAGAACCTGGC
GGCCAATGTGGCCCTCGCCGTCGGGGCGTCGCCCATCATGGCCAACAGCGGCGCCGAGGCTGCTGATCTGGCCCGCCTGC
CGGCCAGCGCCCTGCTCGTCAACACCGGCTCCGTCACGCCCGAGAGCGTGGCTGCCTACGTCCAGGCCATTGCGGCCTAC
AACGCGGCCGGCCGGCCGATCGTCTACGATCCCGTCGGGTGAGTGTCTGTGCTGTGTGCCTGTATCTCATCATCGCACAA
TCTCGTTTGTTCTCACACCTTCAGCGCTGGCGCCACAGACGTCCGTCGAGCCGCCGTCCGCACCGTCATGGCCGCCGGCT
ACATCGATGTCATCAAGGGCAACGAGGGCGAGATGCAGGCCGTGTATGCCGCGGGCAGCAACCCGGACGATGGCGACTGC
CCAGACAGCTCGTCGGCCCAGCAGCAGCGCGGCGTCGACGGCAGCAGCCGGCTCGACGGGACAGCGCGTGCTCGCCTGGT
TCGCCGTCTGGCCGCGCGTGAGCGCTGCGTCGTCGTGCTCACGGGCCCCGTCGACTACGTGGCCGAACCGACAGGTTGTC
ATGTCCTCGCCGTCGCTCACGGCCACCCGCTGCTCGGTCAGGTCACCGGCACTGGCTGCACCCTCGGCACCGCCATCTCG
GCTGCCGTCGCCGCTGCCGGCGTCCTGCGCGAAGAGGCCACCGATCCCTCAGCTGCATCCGTATTTTCCACCTTTCACGC
CGTCGTCGCTGCCCTCGTCCTCTACGAACGCGCCGCTGAGCTCGCTGCCCAGTCGGCCACTGTCGCCGGCCCCGGCTCCT
TCGTGCCCGCCTTCCTCGACTGCCTCGCCAGCTGCCGTCACCGCGCTGCTGCCGGCGACATGGCCTGGGTCCAGGACAAC
TACCGCATCACAGACGTTTAGAGACACATAGAGCCTGTGGCTGTAAATTCATGAGAAGCGTTGGAATGTCCTATCTGGGA
AGGTGCACGTGCTCTCGTTCTTGCCTGGCCCCACTTGGTCCCACCATATCATTCGTACTCAGATCCCATCATCATTGATC
CTCCATCTTCATTACACATCACCATGTCTGCCTACTGCTGCACCTGTGCAGCCCCTCTGCCCATCGGCTCATCAGAGAAA
ACGCTTCCATGCATGCCTGTCGCCCGGCAGTTGCCGTGCTGCGACCGCTTCGTCTGCGGCCGTTGCTTAGAGGCAAGTCC
ACTGCGTCTTCTGTCTCCCATCGGCTGGCTGACGTTCTTCCCCTCTAGACAAACCCCCCCTTCGCCTCCTACTGCCCCTA
CTGCCAGATTGCTTCTGCCGCCTCACCCGCTCAGCACCTGCTGCCTCCCGGACTCAAGCCTCCACCTCCATATCGGCCTG
GCAGAGCCCCCGCTTCATCTGACGCTCCGCCGCCTTATACGGCTGTCCCGCTGACTAAGCAGACCATCGTGGACGACACG
CCCATCCTCCACCATCTCGACCACGACCGCGACTCCATCGCGTCACTGTCCTTGCGCTACAACGTACCTGCGGATGTCCT
ACGCCGCACAAACCGCCTGGCCGTTGATCATCTGTTGCTGGGCCGTCGCGTCGTCGAGATCCCCCGGCTGTCCTCGTCCT
CTTCGCCCGTCTCCCTCTCTCCCAACCCGGTCGAGGGTGAGGTCGAGGCTCTGCGCAAATCTCAGATCCGCCGCTTCATG
GTTGCCTGCAAGGTTGCTGACTACGACCTCGCCGTCCTCTACCTCGATCAGGCTGCCTACGATCTCGCACCCGCTATCGC
TGCCTATCAGGCCGACGAGCTGTGGGAACGCCAGAATCCACAGGTCCGGAACAAGATCAAGACCAAGACCAAAACCTATA
ATCGCACCAGCCTACTCTCTCTTGTCAGACCACGTCCACCACCTGAGACAGACAAGCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62