GenePrediction:GLEAN_5799 Details

Name: GLEAN_5799
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:888655..886965 (- strand)
Length: 1691
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:888655..887061 (- strand)
Length: 1595
Type: CDS
Source: GLEAN
Position: GCSC_173:886995..886965 (- strand)
Length: 31
>GLEAN_5799 class=GenePrediction position=GCSC_173:888655..886965 (- strand)
ATGGTAAGGTCAGAGCCGACGGTGCGGGCGATGCTCTCGAGCATCTGCCGTCAATGCAGGCGGCCGACAGGACAGCGAAC
GCCGCAGCCGGCTGCACGACAGCTGGGGGGCAGCCGAGGCGAGTCGATGTGGGCACGGGTGGCGGCGGGCGAGGCGAAGA
GCGCAGCAGGAGCCGGTGGTTCCGGTGCCAGCTCGCCACGGCCGGCGCTGCTGCGGCCACGCTGGTCCGAGGAGGAGGGG
GTACACCGGACAGCCGTGACGGCACAGCGGCGGAAGTCGTCGACGGCAACGACGACGACGACGACGGCAGCTAAGACCAA
GGGCAGGACAGAGCGGGTGTTGGCAGCCGATGACCTGTTCCACGCGTACAGCAGCTCGCCGATTGCCGACATGCGACGAC
GGGCGGCCTTTATCAAGATGCACGCACACTGTCCACACCCACACCACAAGCACGGAGTGATGGGCGAGACGACAGCGGCG
GAGCCGGACTCGGCAGCAGCGCCGCAGCTGAAGGCGCTATCGCGGCTAGAGGGCGGCGAGCTGGCGCCGGCGCACGTGGA
CTTTGAGTGTCCGGACTGCGGGGTGCCGGTGTACTGCAGCGAGGCGCACTGGATGGACGACTACGAGGCGCATCTGCAGA
TCTGCGACACGCTGCGGCAGATCAACGAGGACGACCACGACCTGCGGTCAGGGCGCGACTTTGCCGAGTTCGACTACCCG
GGCGAGCAGATGGCCGAGGCGCTGGTCAACATGACCAGCTGGGACACGTTTCTGTACACGCGCGGCTTCTCGGCCGTCAA
CGACGACCGGAGCATGCGCCAGGTGACGCGACTGCTGACGTATCCGGTCACGGTGGCGAGCGTGCTGCACGAGCTGAGCC
CATACAACATCCGGCGGGGTGGCCGGCTGACGGCCGAGGGCCTCAAGAGCCTCAGCGCCCTGCGCTACACGCTGCACCCG
CCGCTGGCGGGCGAGTCTGACAGCGTGCGCGGCATCCGGCCACAGGCCCCGGCCGTCCGGCTGTTTGTGCTGGGCGCGCG
TGCCGAGTCGTCGCTGCCGCGCGATGTCTGGGTCCAGCTGGCCCATCTCTTTCCGCGCGCGCGGCTGCATGTCGTCCTGA
TCGGCCCCGAGAGCATGGCCAATCGCGACGACGAGTTTCCGCTGCCGGCGCGCACGGCGACCAATCCGTTTGGTGCCGTG
GTCGAGGACCGTGTCTGGCCAACCATGAAGATCACCACCATCGTCGACTACTTCCACACCGTTCACCAGACCGGCTACTT
TGCCCCGTACGACCCCTACTTTGACTGCTTCATGCTCTTCCACCCCGGACTCGGCCACCCGACCAGCTCGCACGAGTGGG
CCACCACCCTGCCCATGCTGCTCGAGACCAAGGCCCCCGTCCTCGTGACCGGCTACACCCAGCACGACATGGAGCGCGAC
ATCGCCTGGGTCGGCCGCACGGCCGCCGGCGAGTTCGACCTGCTCATGGAGCCGGGCGAGAACATCTTCCGCAGCTTGCG
CTGGGATCTCAACGACCTAGACCCCCAGGACATTAGCTGTGGCAACTGGGGACTGTGGGCTTTCCGTGGAAAGAGGTGTG
TTTTTTTTCTCTCTTTTTCTCTTTCTCCTTCCTTTCCCCTTTCTCCCACTAACAATCCAGATACGAGGCTACGCATAAAC
CGTCCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62