GenePrediction:GLEAN_579 Details

Name: GLEAN_579
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:717685..718650 (+ strand)
Length: 966
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:717685..718650 (+ strand)
Length: 966
>GLEAN_579 class=GenePrediction position=GCSC_97:717685..718650 (+ strand)
ATGGACGCCATCCCGATCCAGCCGCTCTCGCTGTCTCCGGCAGCTCCGGTCGGCTCGTCTCTATCGACGCCGACGTCGCC
GACTTCGCCAACGTCGCCGACGTCGCCCTCCTCGACCAGTTTTGCCGCCCGTCGTTCGCGGCACGGGCCTTCGCTCTCGC
TCGACCTCTCGGGCCTGCCGCCGCCCATGCTGATGCACCAGCCGCCGGCCGCGACGGCGCCGACCAACACGCTTCTCCTG
ACCAACCTGTTGCATCCAGACGTCTTCCGGCCAGACAATCTGCAGACGCTGCGCGAGCTGATCACACAGACGGCACCGCT
GCACTCGTGGGCGCCGCTGCGGTCTTTCCGCCGCATTGTCGTGTCCTTCTTCTCGGCCGCCGACGCCGTCCGCGTTCGTG
GCCTCTGGGAAAACAAGGCCGTCTTGGGCGAACCCGTGCAGGTCTACTATGGCCGTACCACGCCGCTGGATGTTGGCGGG
CCTGGCCAGATCCAGCATCTCGCCCTGCCTGACGCCGGCAAGCTCTTCTTCATCAGCCCGCCACCGTCGCCGCCACACGA
CTGGCAGATGCGCCTCGAAGGCGCCCCCAACAAACAGGTGCACGCCGACGATCTCGCCGAGGCCCTCGCCCGCCTTCATC
ACCAGGCCTCGACTGCCGACCAGTTTGACGTCGGCAGCCACCAGAACAGCAGCCAGACCGACGTCGCCATGGCCGACATG
CCCTCGCCCGCCAGCAGCACCGCCGCCAGCCGCTCCGCTACCTTTAACGCCTCATCTACCTCCCGCTCTACCCGCAGCCG
CAGCTCCACCCTCGTCATCTACCAGCCCGCTGACCATGGCTGTCTCGGCAGCCTGCCCGCCATCGCTGTCGAAGACCTCA
CCGCCGAGCTCGACATCGAGCCGCCGCCCGCCCCCATCATGGCCCATACCCAACGGCCGCCCGTCGAGCTGATGAACGAC
GCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62