GenePrediction:GLEAN_57 Details

Name: GLEAN_57
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:385662..387608 (+ strand)
Length: 1947
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:385662..385986 (+ strand)
Length: 325
Type: CDS
Source: GLEAN
Position: GCSC_179:386045..386296 (+ strand)
Length: 252
Type: CDS
Source: GLEAN
Position: GCSC_179:386359..387608 (+ strand)
Length: 1250
>GLEAN_57 class=GenePrediction position=GCSC_179:385662..387608 (+ strand)
ATGGCTGCTCGGCGTCCCAGGTTTCCGAGTTTGCGAATCCCCTCTGTTCCGGGTTGCGTCTTGTTGCTCTCGCTGGCTGT
GCAGCCGAGACTTACGTCTGGAATCCAGGTCACTCCCAACTCGCCGTGTTCCAGCATCTGCATCGACAGCAGTGACCTGG
ACGTATCCGACCCGAACTCGTCCAACACACTGAAAGCCGACCTTTCGTGTCAAGACTCCGACTTCACCTCCTCTACGGTG
GGCCAGAAGTGGACGTCCTGCCTCAGCTGTCTGCAGAACAGTACCTTTTCCCAGGGCAGCGAAAACGACCAGGGCTGGTT
CTTCTGTAGGTCCAGCTAGAGCCGTGGTTGGGATCCTGTTCGACAGCTTGCTGACAGCCGCAGACAACCTGCGGTACAAT
TTCGACTACTGCATTTTCGGCTATCCCAATGGATCCGACACCGGGACCAATCCTTGCCAGACAACGACGGCTTGCGGGCA
GTTGCTGAATGCGCTGGAGGATGGCATCCCCGGCATGGGCAACCACTCTGAGTTTGACTACTGCAGCGTGGACAGCAGCA
CAATGACTGGCAGCGCCTACAGTCAGTGTCTCTCGTGTGTGTCTGCCTTGGACTCGGGCGTGACGGTATCGAATGGTAAG
ATGCAGTTTGTCGACAACGCAACGCAGATGCCATAGCTGACGAGTCCCTTTTTCTAGCCCTCGTGGCCCTGGAAGCCGGC
TGTATCCAAAAGCCGTCTGGAGAGTTGGTCGTTGGTCTGAGCGACAGCGTTTTTGCCACGACCGTGATCAGCATCACGTC
GGCCTCGAGCACAGCGTCCAGCACGTCGAGCAGGTCCAGAGGGTCCCACATCCGGACAACCACTGCTGCGGCCATTGCGA
TCGTGGCCGTCGTGATCGTGGCGGCAATCTCTGCCGTCACCTTTGTGCTATATCGCAAGCGGAGGGCTCAACGCAGGCGA
AGCGGCGGATTCGGCAACGGCAGTCAGGGCATCAAGATCGACTCGCTCGGACTCGGCGGTTGTGACATTGGCAGCCCCAT
CCCCGGCGGCACGTTTTCGGGTGGCCTGAACCGGATGTCATACCTGCAGCCGATGTCGATGGCTTCAACCATGATGCAGA
ACGAAAGTACGTTGGAGAAGAGGATGGGCAGGCCGGGTCTAGCATCGGAATCGCCTCTACACGTGGGTATGCAGTTTGCT
CCCGCCTCTGAGAGCAGGAGAGATATGTCGGAATCGCAGCTGCTGCCCCTGTCACCATCACCCTACACGGTGACATCCGA
CCTTGCCTGTCCGCCGGCCTCCCATCCCCAGGCCAGACTGCCAGAGCTGCCACAGCTCACCACGTTGCTGCCGAGAACCT
CTAGAAAAGAGCCATTGCCGACGTCGGCTGCGGCCGCGGCCAGCTTGCAGCACCTGTCGCCGATGTCGCCGCCGTCTGCG
TTTACACACACGCCCAGCAGCCAAGGCGGCTACTATGGCGGCGGCAATCGTATCAGTCCAACCATGTACGACTCGCCGGT
GTTCTCGACGCCGACGTCGGCCACAGCACTGCTCCCGGCGGCGACAGCAGCGTTCCCCGATGCCAGCATGTCACCGACGG
CACAGCTACGGCAGCAACAGGCGCAGGCGCTGTTCGCGCCATACATGCCGGCAGCGTACAGGCCGAACGCGGAAGACGGC
GGTGGCTACAGCGGGTTTGGCGGGCTAGGCATTGTGTCGGGCAGTATGCCATCGCAGCCATCAACAGATCTTCCGCCACG
TCCGCTTCACAACAGCGGCTTCCATGGCGCCACGTCACCTGACAGCATGGGCCATCTGGAGCGCATGGACCTAGAGCTGG
TGCAACAGGCGAACGTGCCCGGGCGAAAGAAGGCAAAGAAGGGCGGCAGCCCGGAGTCGACACAGTCGATCAAGGTCGAC
TTTCCTGGGCCACCGGGACGGAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62