GenePrediction:GLEAN_5800 Details

Name: GLEAN_5800
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:886476..884291 (- strand)
Length: 2186
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:886476..885759 (- strand)
Length: 718
Type: CDS
Source: GLEAN
Position: GCSC_173:885672..884817 (- strand)
Length: 856
Type: CDS
Source: GLEAN
Position: GCSC_173:884477..884291 (- strand)
Length: 187
>GLEAN_5800 class=GenePrediction position=GCSC_173:886476..884291 (- strand)
ATGGCTGCCACGCCGAAAACGAACCCGAAATCCTCTCCGACGACTGCCCAAAGCCTCACGACAGCAGCTGCCATCGCAGC
CGCCGCTGCTGCGTCCATCTCGCCATCGCCACCGCCATCACCGTCTCCATCGCCACCACCACCACCACCACATACGCCTG
CCACCGCCCGTCGAAGGCCGCCCGGACGCACAGCCGCTGCCGCCGTCATCGCCGATCCTCTCTCCGACAAGGCAACGATT
CTGCTGATCCGACGGACCCTCTGTGCTGACGATGTCGGCCAGCCAGCTGCTCTGGGCCACGGCCAGCCCCCGGCTCCGGT
CTCAACGGCCGCCCAACCTCAGGCTCTGACGCCGACGCCGACGCCGACGCCGACTGCCACGGCTACAACCTCTACAATCT
CTATAGCTCCCACAACCTCCATCCCAACCACCACCACTTCGGCCACTCCGCCTCCACAAACACCCATCGAAGAACTGCTG
CCACCGCTGACGAGCCGCAACGACGTCGACCTGCAGTTGTACGCCCTGCTGGCCGTCGTCGTGCGCGAGTTTGTCCAGAC
CTGGTATTGCCGCATCACCACCGACAGCCAGTTGGCCACCGAAATCGTCCACATCTTTGCCCACTGCACTCGCGCTCTCG
AACAGCGGCTGCGCAAAGCCGACCTCGAAGGCCTCGTCTTTGACGAGCTGCCAGCCTTGTTGGATAACCACGTCCAGGGT
GAGTTGTTGCGTCTTGCCCCTCTCTGTCTCCTCTCTCTCTCCTCTCTCCTCTCTCTCCTCTCTCTCCTCTCTCTAACCTC
TCAGCCTACCGAATCGCTCACCAACGTCTCGTCCCACTGCCTGTCCAGACAGACCCTCGCGTCGTCTATCACGCTCTGCT
CCCGCTGCCGGCCCTTGAGCCCGTGCCCTCCGCCAAGTCGGCCGAGTCCGTGCTCAGCCAAGCTGCCAACGAGTCGGCCT
ACCGCCAGCTGCTCGTCAGCGGTCTGCTCGCCGTCCTTTTGCCCACCGAGGACCTCGAAAACGAATGTCTGACATCGCTT
CTTAGTCAGATCTTGTCCGAGCTGCTGCTCGGCAACGTCTTGGCCGGCCGTGTTGCCGAACCCTGGATGATGTGGGAGAT
TGTCGGCATGTTGGCTCGCCTGTTGCGTGAGAAGATCGACGGCGAGAACAACAACACTCTGCCAAATTCGACGACAAAAT
TGCCTCAGAAACTGCGCTCTCCTTCGCTCACTCCTCCGCCTACTCCCTCGCCTTCCTCCTTCTCGGCTCTTTCCTCCTCC
ATCTCCTTACGCTTCTCCTCCTTTTCCTCTACCATCACTCCCCTCTTCTGGTCGGCCCTGCGCATCGGCTTCGCCCTTTA
CGCTTCCCTCCGCTTTCTAGTTGCCAGCATCAGCCTCGCTCGCTCTCTGCCTCCACGTCAGCTCCAATTCTCCGACCAGT
CTATGCCAGCTAAGAACAGCAGCCTTCCTGTCGCCCATTCCGCTGCTCATCTTCTTCCCTCTCCACCACCCGTCTTGGCC
TACAGCCTGTGGCCTGCCGTCGCCAATCTCGTCGAGTTCAATGTCCGCATGCCCTGGCTCAGCGGCTGTCTGTCCATGGT
CCAGTGGTTGGCTTTGACCGGTCCAGGTCGTATCGGTGCCTTCGACGGGCCTCTTGACAGGTAGGCATCTCCCGGATTAT
GTAATCACGTTTTTTCTTCTTCTCGCTTCATCTTCGCCCCCCAATCTCTCTGAGCACATCTGGGCACATCTCATCACATC
TCATCTCTCGCCCTCGCTTTCTATTCCCCCTTTGGAAGGCGGCAATGTTGCATCATCCCCCCCTTCTTCCCTGCTTCCCC
CGTTCAATCCGCATGTGCTTCTGGTCACTGGATTTGTCTGAAGTCTGCTTATCCCCTCGCCCTTCCGACGACGATGACAT
TCGTATGTCATATTTCGGCTCGGTGCTCTGATCCTTGCTCTATCTCCCCCCACTGATATCACACAACGTCGACCCATAGC
ATTGATGTCGATGAGACCGAGGAGCAGCTAATCCAGAGCGTATCATCGTCTCTGGCCTATCTCTGGTCTACGGCCTCTGC
ATTTTGGGCCAATCGCATCTCGGAGAAGCCGTTCTGGCTTCCTATTGCTCAATATCCTCCCCAGCAACACCCAACCAACC
GCTCTCGTTTACGCGCCCAAATATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62