GenePrediction:GLEAN_5801 Details

Name: GLEAN_5801
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:883567..883056 (- strand)
Length: 512
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:883567..883560 (- strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_173:883431..883056 (- strand)
Length: 376
>GLEAN_5801 class=GenePrediction position=GCSC_173:883567..883056 (- strand)
ATGGGGGAGTGAGTTTAAGGTCAAGTACCCGTGATGTGATCGCGACTCCAGTCTCTTTCCTCTTTTTCCCACTTTCCCGC
CCAGTCTAAGCCTCTGTTTGATGGCCGATCCTTGCAGGACTGACTCTTCTTTCCAGGCTCCTTTCCTACTATCTGCGAAA
ATATGCCCTGGATGCTGCCCTGTTGCCGGCCCTGCTGCGCTCCATGCGCTCCGCCGTCTTCCCGGGCAACAAGTTTGGCG
CAACGCCACCCACACTCGTGGCGCCAGCAAATGCCCACGAAGAAAAAGCCCTGAGACGACGGACGGCCGAAGCTGTGTGG
GCTGTGGCCAATGGCAATCGGGCTGCCTCGGAAGCGACGCTAGCCGACATCGATGGCGTGCTGGACGTCTTCAGTGACGC
CTATTGCAACAAACACCTGCTGTACGGCCTGCTGGAGGCTATCCTGGTACGCCTGTTGCCAGAGATGGCCGACACAGGTG
TGCTGGGTCTCTGGGAGGAGCGCCTAAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62