GenePrediction:GLEAN_5802 Details

Name: GLEAN_5802
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:860260..855974 (- strand)
Length: 4287
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:860260..859533 (- strand)
Length: 728
Type: CDS
Source: GLEAN
Position: GCSC_173:858518..858305 (- strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_173:858182..857855 (- strand)
Length: 328
Type: CDS
Source: GLEAN
Position: GCSC_173:857793..855974 (- strand)
Length: 1820
>GLEAN_5802 class=GenePrediction position=GCSC_173:860260..855974 (- strand)
ATGGCTGCGCCCTACCCCCAGGTTGTCCTATTTGGGGACTCGCTCTTCGAACGCGCCACTGAAACCAAAGATGGCTTCTG
CTTCCAGGCTGCCCTCCAGTCACAGTGTGGGCGAGTTTTCGACGTCGTGAACCGAGGCTTCTCGGGCTACAACACGTCCC
AGGCACTCAAGATACTCCCCAAAGTCTTCCCGGACCCAGCGTCTTCACCTGGCCCGAAGCTGGCTTATCTGCTGGTCCTT
CTCGGTGCCAATGATGCGGCTCTGCCCCGCTCAGAGAACAGCCAGCACGTTGACCTGCAGGAGTACGAGAAGAATCTCAA
GACCATCCTGACCCACCCAAACATTCGGGCCCATAAGCCCAAGATTCTCGTCGTGACACCGCCTCCACTGGATGGCGTTC
GGTACGGTCAGCTCTCGAGGCTGAATGGCGAGACGACCACCTCCCGCCAGGCTCCCATCACGGCACAATACGCAGAAGCA
GCCCGTCGCGCCGGTGTTGCGGTGCCCGATGTCACCGTTATCGATTTCTGGAAAACGCTGATGGACCGGGCTGTCTCCCG
AACGCCCGGCTTTGAAGCCAAGGATGGCGTCCTGCTTGGAGACGAGGCTTCAGGCAAAAACGGCTACCTCGCCAACCTGC
TGGCAGATGGCCTGCATCTTTCTGGCGAGGGGTATCGGCTGCTGTTCGAAGATGTACGCCACCACATTGAACAGACTCGA
CCGGAGTCGTATGTGCACCCAACTTGGCAACAGGCGCCTTGGTTGTAGACGGAGTGAAGTGGGAGAATCCAATGGTAAAC
TTAGCTTACGACTTACTTCATCTATCAGACTATATTATCTAGATAAGCTACGAGTAAGCACCAAGTGAGTTCTGTGACAG
AAGGTGCGGTTAGCATGGGCTGCGTATGCATTCGTGTTGGTCGTTGCACCTTCCTTGCTTGTGAAAATAGGACGTACTCC
TTATGTTCATAGGCAATTCCGAGGTTTAGCCTTAATAATGCGCTTTGCAGGTAGCCTGTAAGATGCTGCTGAGGGAATGC
AGTACTCCAATAGTGCAGTAGCGCATTCCAGTTCCTATTCCACAAGAAAATCGCTGAAACTCGAATCGCCGTCATCTACC
CACAAATCGAAACGACCGCCTTCCCGACCTTTCTTTCATCTTCACGTTTTCACCAGGGATTACTTTAACCGCCCCCCTCT
CTCACCCCGACAAACAAAATCTCCCATACAGCATACAACCTCAAGCACCAACGAACTTGCAGCAGAAAAGCAGCGTCTCG
CTCTTTTCCCCTCATCGCTCTGCTTCGAAGCACCTGCCTTTATTTCCGTCAGATACCATTCGTACAATTGACCCCTGCCT
AAGCTCACTTGGCTCAGTTTTACTCGACGGGGCCTCTTCTGGATCACCGGCGCTACTATACGGAGTACAACCCACTGCTA
TCGCCTGATCGTTTCTGCTCCTAGCCGGCCGCGGTCGAAGAGCACCCCGTCTTCACCTGTTCCGATTGCTTGATATTGGC
CGATTCGGACGAGAAAGCTATACTTCAAGCCTCGTGCGTCACTAATTTTCGCTACCCAGCCTGGTCAATTGATCCTCTGC
TCTTTCCTTTCCCTGCTGCGATACCCAGCTGGTCAATCTTACCTGTCACTTCCCGGCCCGCCTGACACGTCGTTCTATTT
GAACAGGCTACGGTCAACTCTCGCCTTCCTTATAATACGAGCCCTAACTGCACCCCATCCAGCCTTAGTGACGACAGCGC
CGAGATCTTCAGGCCCTCGAACAAGACGGCAATATACTCGCTTTCCAGTGACCAACACGTTACAGCCGACAGAACGCTCA
TTCTCGGCAGGCCGCCTGAAGAGACCAATTTCGAGCGGAATTTCTGCTTGGCGCGTTCGAGGTGGCTGGCCAGAGAGGGA
CAGCCGGCCGTTGCCGCAGGAGGTCTTGAGTGCGATGTGAGAGGTGGTGGAGAGCGAGACCAGACATTCTAAATTCGAGA
TACCGGGGAGGGAAGTATTGACACATTGTCGAGCCACAAGTGTGTTCAAAAGACGGCAGAAGGTTACGGTGGCAACAGGC
GTTTGAAACGCGCAGATATTCGAGACCTCTGTTCCTCTACGCTCCATCCTACGATATCCCTTCCACCCTCTCGGTTGCCT
TGTCGACTTTGTTACTCTCGCAGTCTCCATCACTTCGGCCGGATTCGGGCATGGATACTCGATTCGTCGTTAGTCGAGAA
GAGTTCCACAATGTCCAGATGGACGTAAGGCAAATCCATGCCGTGCAGGCTAGCCAGAATGAAAGGCTGCTGCGGCTGGA
GAAGCGGTATCAAGATGATTCTGCCATACGTTCCGCCTGGTCGAACTCGCCGTTTCCCAGCGCTCTGGTGGGTACGCCTC
AACATGGTCAGTGCGTCTCTTTGAAGTGAACACAGAATTTGTGCTTACAATACCTTGGCTTATGCAGGCCCTGTCAGGAT
GCCCTCGACGGAAGCATTTGACTTGGACGAGCAGAGCCAGACGCTTGGGTCGTTGCATCTTGATCCCGATGACGAACCAG
TTCGGCGAGCGGCTGCGGCCTCACGGGCCAATAGCGTACGCTTTGACGAGAGCGCCAACATGACGCAAAACGCGCGCCAC
TTCAGTGACATGGGCCCTTTCCGGCCCGGCAGCAGTCTCATGATGGAGCGCTCGCTCTCACATAAGTCTGACGGCAGACA
CAGCTCAGCCGGTCACTCAGTACATTCCATGGCATCCGGCCGCGGTAGCAGTATCGCGCTTGAGACGAACTATATGACGG
GCGGTCACGAGCAGGACTCGCCCCTTGATATGCCCGAGCCGCCGCCAGTCTTTTTTGTCCTCGGATCCGTTCCCGCCATA
ATTCGTTGCTGGCTCACAGAAGACTTTGCCAGCGACACCCTCCTGTACGCTGCCGTGTGTTCGGGTGCGCAAAAATCCAC
CGTGGAGCTTTCGCTCATCAAAGAGCTCGGGTTGACGGATCTCATCTACCGAGATGTGGACAATGCTTTCAAGATACACC
TGCAAACTTATCTTGCCGAGGCTATACCGGCCACAAGGTCTGCCGATCCCGTTCCTCAAATCCCCTCTTTGTCCATTAGT
TTTGAGGTCGCCAGCCTGGATCAGACCACAGAGGCCAGCAATCGCAAAAAGGGCATTCGTATCATCATCGGCAGCGACAC
GCTACGAACCCACAGTGCCGATGTCTTGTTTTCACGGAATCTGTTGTGCATATATAGCCGCGAGCGAGAAAAATTGTCTG
TGCCGTTTGTACGCCCTGAGGACGACGCCATATTTAAGAACTTATACACGTCCAGTGTCAATCCGGAGAAGCCGAAGCTT
AACGCCGCAGCAGCTGAGTTCATCGCCGGCGATCTGAAGTCTCGGGGAAGCATCGACGATGGTTATGAAGAAGAGCAGCA
TGTGTCTCGAGAGCAACAAGCAATGGGCTCACAGGGAGGGCGACACAGACAGGAGGAGCAGTCGGCCAAGCAACATGATG
ATCTTGCATACCACAAGCAACTTTCTTTTCAAGAGCAAGAGACCGACGTCCAGATTGCCAATGGCAGCTTGACGGATCCG
GGCGACGTTTCTCCAACGACGACTCACGTTGTACCTGCTACCAAGTGGCCCAGGGGCACGACAAACCTGTCGGATAGCGG
AAACGAAGGTGAGAGGCAACCGCGACACTCAACCAGCTCAGAGCGTTCCGGAAAGGAGGCAGGCCCTACGTCTGGAGGTA
GTCAACGTAATGCGAGTGCTATTTGGGGGTCTTGGCGCCAGGTTGGCTCTACAACTGGGAGCGATGGCGGCCATCGCGAG
AACGGGTCCATAAGTGGATACCAGCCGCCCCGACAGCCAAGAACTATGAAAGTTTTGAAGGCGAAAACAGGGGGCAGCTC
TACATCTGTTCGCACCGGATCGTCCTACGAGCCTCCGCTTCCATCTCGTTCGGGTGGTGAGCATCGGAGCAAGAGCCAAG
CACCGTTTAACTCGGCCAATGACGGTGGAAATGGCGGCGGAGGAGGTGGAAACAGCAGCACGGCATCGAACGTGATCCGT
TGGGAGTCAAAGCGCACGATAAGCATTAGCAATGCCGTGGCAAACAACGGTGTCAGCAAGGAGAACAAAAGCCAGCAAGG
CCTGGCTGCACTCGAGCTCCGAAACAGCACCACTCCCGCGCCGCGGACTTCCAACCCTGTGGGTGGCGCCTCTGCTTTTG
CATGGATGAAGCCGAACAAGCCAAAGACGCCAACTGCAGCGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62