GenePrediction:GLEAN_5804 Details

Name: GLEAN_5804
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:845830..844787 (- strand)
Length: 1044
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:845830..845812 (- strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_173:845739..845636 (- strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_173:845518..845479 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_173:845345..845280 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_173:845202..844903 (- strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_173:844827..844787 (- strand)
Length: 41
>GLEAN_5804 class=GenePrediction position=GCSC_173:845830..844787 (- strand)
ATGTGGATTGTCAACTGGTGTATGTTTCCGCCTTCACAGGACCTTCTTTGGGAAGATGGCAATTTCTTGGTTCTGTGCTG
ATCAAAAAAAGTCTACGACGTCTTGTCGTCGCTTGGCCTGCTGAACAAGCACGCCAAGCTGCTCTTCCTAGGCCTCGACA
ATGCTGGAAAGACGACTCTGCTGCACATGCTCAAGGTAAGAGCCATTTCAACGAGCGGCCAACAGGCCAGCTGTATGGAT
CTTGCTTCCTCTTTGTTCCGGGGACTTTCTCGTCTCGATTGTGTCAACTTCTGCTAACTCGTCATTCTGCAGAACGACCG
TGTAGCGATTCTGCAGCCGACACTCCACCCAAGTTGGTTTCCTCCTCTCTTCCTTCATAGTCTGCTCGTTTCGGTCGATC
TATGCCGCACTCGAATCTGCTCGTGACTCATCGTGACAGCTCGGAACGTCCATGTGGATCCCTCTTTACTGACGCGCGAC
TACAGCTTCCGAGGAACTAGCCATTGGCAATGTGCGGTTTACCACCTTTGATCTAGGTGGCCATCAGCAGGGTAAGTGGA
GGAGAAGGTGGAAGAGTGGCCACGGCCCGATACTATCTTGAGATCATGAACTGATGCGACCTCTCCAGCCCGCCGCCTGT
GGAAGGACTACTTCCCCGAGGTCAACGGCATTGTCTTCCTCGTCGACGCCAAGGACCTCGAGCGGTTCCCCGAGGCCAAG
GCCGAGCTGGATGCCCTGCTGTCGATGGAGGAGCTGTCCAAGGTGCCGTTTGTGATTCTCGGCAACAAGATCGACCACCC
GGACGCCGTCTCGGAGGACGAGCTGCGCCATCAGCTGGGCCTGTACCAGACGACGGGCAAGAGCAAGGCGTCGCTCGAGG
GCATCCGGCCCATTGAGCTGTTCATGTGCTCGGTGGTGATGCGGCAAGGTACGAGAGCGGACCTGTTCTACATCTGTCTG
CTTGCTAGGACGTCGCTAACTCATCTTCTTTGCTACTCTCTAGGCTACGGCGACGCCATCCGATGGCTGTCGCAATACGT
GTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62