GenePrediction:GLEAN_5805 Details

Name: GLEAN_5805
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:843983..841166 (- strand)
Length: 2818
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:843983..842750 (- strand)
Length: 1234
Type: CDS
Source: GLEAN
Position: GCSC_173:842679..841166 (- strand)
Length: 1514
>GLEAN_5805 class=GenePrediction position=GCSC_173:843983..841166 (- strand)
ATGACAGCGAGAACGGACGGCAGCAGCCATGGGGCAGCAGTTGCTGCTGGCCCTACTTGCTATGGCTTTCCCGTCGAGTC
TCTCGACGACGCATCTGCGCTACCCGACTTCTACACCGACTTCCTCCTGCCCGAAGACGTCGAAGCGTTTATCCAGGCTC
TCGCAGGACCCGATCCACTGCAGTCGCCAGGCGCAACTGGTGCAGATGACGGCCAGCGCAGTCCTGCTGCCAATTTGGAC
CATCTCAGCCGTAGAGCAAGCACAACGGAGAACGGCAGCACGGCTGCGACCATTGGTGACGGCACATCCGCTTCAGCGAT
TGCGCCTACGTCTGCGTCGTCTCTCTTCATAACGGCCAAAAACGACTGGGCCCCGATCTACGAAAAGGTGGTGCCGTCTG
AAGAGAGCCGGGACGCACCAGCAGCAGAGGCCACAGGCTCGGGATTCTCAAAGCCACAGCCATCTGCCTCAAGGCCTTGG
TCGTTTCTGGGTCGCAAACAAGACGTTGCGCTCGCAGCGTCAGGCTCTATCCCGATACTGCAGCCGCCAGCACCGCCGAC
ACTGAGGCGAAGACGGCATCTGCAGCAGAGACCGAAGCAACGGCAACGCGTAGCGGCAGCGTCAGCAGCATCGACGGCGG
CAGGCAAGAGGTCGCGTGCCAAGACGGGACCGGGGCGGCGCACCCAAGACGAGACGCGCGAGGGCTATCTGTACGGACTC
CTGAAGTGGCCGTTCCTGCTGGGCGTCTTTGCCTGGATCATCGGGCTTTCAATAGCGTACCTGGTGACTCGGCTGTACAT
CTCGTCGTATGAACAGCTAGTGACGTGGCGTGGGCGACGCGAAAAACTGCGGAAACAACTGCGATTTGCGCCTGACTATC
GCAGCTGGGTAGCTGCGGCAGAAGAGCTCGATGCGTACCTGGGCAACGACCGGTGGAGGGAGGACGATGAGTTTGCCTTT
TATGACTTCCGCACGGTGCGGCGCGTCGTTGAACAGCTGCGTCGTTGTCGGGCCCAGGCAGAGACAAAAGAAGCGGCCGA
CAGCGGCACGACGGTCACGGCCACGGCCAACTCTAGTGCAGCAAGACTGAGCCAGTCGAAAGAGCCGGTCGGCGATCTTA
AGGCGCTCGTGGAGGCATGCGTAAAGAACAACTTCGCCGGTGTGGAGAATCGGCACTTGTACAGCCAAACGTACTATGGG
ACGAAAAACCTGGTGCAGAGGTTTGTCGAAGAGGGTAAGCGTATTATCCCTGGTAGATCTTCTTCCTGCTATCTCCCAGG
GGCTCCCTGCTAACATGTAGCCAGTTGAGCAAAGCCTTCAGTTCCTCAGCGAGACAAATCAGCTGGACGCAGCCGAGAGG
CGCGGCCTCTTCAAGCGGTTGCACGCCAACTATGGACGAACTGCACTGTGCCTGTCGGGTGGAGCGTCATTTGCGTACTA
CCACTTCGGCGTGGTCAAGGCGCTACTGGAAGAAGATGTGTTGCCGGACGTGATCACTGGGACAAGTGGAGGCGCATTGG
TGGCAGCGCTGGTGGCCACACGGACCAACGACGAGCTGCGGCAGCTGCTGGTGCCGGCGCTGGCTGGACGGCTGACCGCT
TGCCACGATTCGTTCTCCGTGTGGTTACCGCGGTGGTGGCGAACGGGCGCGCGCTTCGACTCGGTCGACTGGGCACGCAG
GTGCGCCTGGTGGACGCGCGGGTCGATGACGTTTCGTGAGGCTTACGAGCGCACTGGGCGCATCCTCAACGTGACGTGCG
TGCCGGCAGACCCGCACTCGCCGACGATCCTGTGCAACTATCGCACCTCGCCCGACTGCGTCATCTGGTCGGCCGTGCTG
GCGTCAGCTGCTGTGCCGGGCATCCTCAACCCCGTGGTGCTGATGATGAAGACGCCGGTGCCGGGAGAAGCTGGTGGCAA
AAATTACCGGCTGGTGCCGTATTCGTTTGGCCACAAGTGGAAGGATGGCAGTCTGCGGACAGACATCCCGCTCAAGGCGC
TTAACCTGCACTTCAACGTCAACTTCACTGTCGTCAGCCAGGTAAACCCGCACGTCAATCTCTTCTTCTTCAGCAGCCGC
GGGTCCGTTGGTCAGCCGGTGACTCACCGCAAGGGCCGCGGCTGGCGTGGCGGTTACTTGGGCTCGGCCTCTGAGGAATA
CTTCAAGCAAGACCTGCGCAAGTGGCTCAAACTGCTGCGTAACTTGGAGTTACTGCCCCGGCCGCTGGGCCAGGACTGGT
CGCAGTTGTGGCTGCAGCCCTTCAGCGGCACCGTGACCATCTGGCCCAAGAGCGTGCTCTCCGACTTTGTCCATATCTTG
TCCGACCCCAACCCGACCCGGCTGGCTCACATGCTGCACGAGGGCTGTCAGTCCGCCTTCCCACCGCTGAACTTTGTGGC
CAATCGCCTGCGTGTCGAGCGTATGGTCGAGCGCGGTCGGCTTGCGTCACGCTTGCACTATGGTAGCGATGGTGGCGTTG
GCGGTAGTGGTGATAGTTTCTGGTCCGGCCATCACGCCGGTGGTGGTGGCAACATTGACTCCATAGCCAGCGAAGACGAG
TTTCATGTCTTGCTGGCTGGTGAGGGCCCGGCTGCCAGGCGCTTCGGTAGCCGCCGTGGTCGGGCCGGTTTGGGTCTCGC
CAGCACGACGGCCACGTCAGACGAAAACATGTCCCTCTCATCATCGTCTTCATCGGACGTTGAAGCTGCAGCAGCTCGAC
CCAGCGTCGGCGACAAGGACGACAAAGCCAGTGAAACCAGTGGGATGGCCAGTTCGCAAAGAGCGGGAGAAGAGGGGCAG
GAGAGCATAGTGAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62