GenePrediction:GLEAN_5806 Details

Name: GLEAN_5806
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:832621..829808 (- strand)
Length: 2814
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:832621..832567 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_173:832504..831184 (- strand)
Length: 1321
Type: CDS
Source: GLEAN
Position: GCSC_173:831101..829808 (- strand)
Length: 1294
>GLEAN_5806 class=GenePrediction position=GCSC_173:832621..829808 (- strand)
ATGAATGACCCCTTTCACCAAGGATTGACCCCGCAGATATCTTTGGCTTCATATGGTATGTGCTTTTCCTTCGCCTGCTC
TCTTGTATTCCCTCAGCGACTGACACATTGGCTTTAGGCCATATTGACACTACACTCGACAACCACCTGCAATCCGTCGC
CCGCCAGAATGCCGACACATCCACCCAGGCTGTTCTGCCCTTTTCAAGTCCGGAGACCCGCACCATGATCGTGGCTACCG
CTACCAGCAATGCAGAGTCCGTCAGAGGCGTCATCTGTCCTGACTGTCAAAAGCCATACCGGCGCAACTGCGATCTAAAA
CGGCACCTGAAGACACACACACGTCCTCACAAGTGCCCAGTTAGCAGCTGCAGCTACAGCACCACCGGCTTCCCAACGCC
GCAGGAGCTCCTACGCCATAAAGACGACCGCCACTCAAACAAGCCGCCCGAATTCAAATGCCAGTTCGCACCTTGCTCGT
ACAGGTCCAAACGGGAGTCGAACTGCAAGCAGCACATGGCCAACGTCCACAGCTTGGCCTACAAGTACAGCCGGAAGAGC
CACCGTGCCCGTGTTGCGGCTACAATCACGAAACCTGACTCCTGTACCCAAGGTGTCCGCCCTGGGGATACCGATCTGCC
ATATTTTGACTTCACCCTGTACCCAGACCAAGACCAAGACCAACAGCAGACCACCAACCATCCTTTGACTCCGGCACCCG
ATGTTGTGTATGGAAATGACGACACCCCCGTTGTCTGTCTGGGCGGAAACATCGCTGATGTCGGTGACGAGAGCGGCTCG
AGTGATCAATCGATCGTGTCGAATTCTTTTGTGCCTTGGGAGTCGCCTATGACGCAGCAAGAGGAAATCCACAACATGAT
CCAGAATGTCGACAGCAATTTTGACCCAACGCAACCTGTCTATGATAGCAACAATTGCTCGCAATCCCAATATCCTCTAT
CAATTCGGTCGCCATTTATTGATCAGTTGAATACCGCAGACATGTCACCCCCAACCATGTCGCACCCGTCATCGTTATGG
TTGCATCCGCTCGAGGCTGTTCAATCTTGTCAGGACCTGCAGCCATACATAAGTGTACCGAGTTTTGTAGACGGCCTGGG
ATCTGTTGGTGTCATGCAAGCTGCAGGACCCCGGGAATCTTATAGCAATCAGATTGTCTCGCAAGCAACTGAGCGAGTAG
TTCTGTGCTCTCCCGTCGACGAGGTCGCTGCCGAAAAACGAAAGCGAGATAGGGACGAAGAGAGCGACGAGGACGACGAT
GAAGACGACGAGCATCGACGCAAACGACCGAGACCCGATGGCGAAACAGACGACAGCAGTCTCACGTGCCCATTTCGCAA
GATGGATTCAAACTATTATAGTCGTGATAGGGATGAACGATACTCATCCTGCTATACACCTCACGTGTATATCTCGACGT
TGGTGTGAGCGACCATCCCTGTTTTTTTGTTTCTTTGTTTCTGTCTTTGTGCCTGCCGCTAACAGCCTGCCTATGAATAG
TCGACACCTTGGCCGAGCCGCACATGGGCTCTTGGTTACTCCGCGCAGCATCTCCTCGTTCGACGTTCTCGAGGAAGGAT
ACCCACGACCAAGAGCTGGTCTCTGTCGCAAATGCTGGAGGCCGTTTCACGACAGAAACGACTTCGATACCCATGTCACC
GCCCCAAATCAATGCGGCAAAGCCTCCCGCGGAAAACGGGAAAAGTACAACGCCATCATCAATGCGTTTTGTGTGCACGG
AGATGGTTCTGATGTATCAGTATCTTATAAAGGACGAGATCTGCTACCTGCGCAACCAATCAGACGCAATACAAGATCAA
CTAGGCGCGATGACCAGTCTCAGGCACAAACCTCCACCGTCCCTCGCCTGTCCGTTGAGTTTGACGCTGCTCGTGGCACT
CCGGATATCAAAGAATCACCAACTCAACAAGAGCTGAAAGTTCCACTTCAAACCGCCCACCTCGTGACTAGTGACTTTGT
GCCACGCATTGAGTATCAAGGTCTTGAAAGGCGCGTCGAGGACTTGGAGGCGGCCATACAACAAATGACTGCCACAGGCC
AAGCACAATCCTCCTCGACAGCACCGAGGTTCGGCCGTCAAAGTGACGGTGACCCAAGGGGCCGAGTCGTTCGTGATATC
ATCAGCCACAGGCGTCCTATCCGGTCTGCCACCTCTGGGACGGATGAAAGTGCACTGGAGATAGGAAGCCTGGGAGGGTG
GATGGAAAGGCAAGAAAGGGTGGAAGAAGATGAGAGGGCGATGCTTGGGACAAATCAAATACCCGGCACCAGTGTCGATG
AGTATACCGGCGCCATCCCCGACAACTCAGCTCAAGACCTGGCTGGCATCAGCAGGCCACACCGAACCTCGACCAACCTT
TCATCACGTTCAGACACCTCTTCTTTACGTCATGCACCACCTATGGCTCTCCGTAGCGATGCTAGAAGCCAGGTTCCCTC
GCGACAGCAACAACAAGTCCAGCCGCAACAGCAGGCGACCTCAAACACGGTTTTGGACTCGGGCTATGGCGGAAGCAGCA
AGCCAAAGGCCTCCCAGCAGCCAGATGGCAGCACTGCGCCACCTGCCACGGCCCTTAACCCCGGCACTCCTGACACGGCC
CCTTATATCTCCATGGATCGGACAGCCGATTCAGCTCTGACAGAGAACCATGTGGCGGAACTCCCGCAAGGAGGCTATCC
GTTTGATGATGGTGTTGAGGGGCCATCCATGTTTGCCGAGATGTTCCTTACAGATACTGAAGGTGAAGTGCTGTTCGACA
ACTGGCCTGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62