GenePrediction:GLEAN_5807 Details

Name: GLEAN_5807
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:826003..824721 (- strand)
Length: 1283
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:826003..825843 (- strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_173:825786..824721 (- strand)
Length: 1066
>GLEAN_5807 class=GenePrediction position=GCSC_173:826003..824721 (- strand)
ATGCTGTTTGCAGACGAGTCCGGCTGGAAGGAGCGGATCGCAGGGTCCCTCAAGAACTCCAATTTCAACGATATGAAGAA
CACAGCGTTCATGCTGGTCATGGCTCTATGGGCCAAGACCACACGGCGCATGCGGTTTGCCGGTGGGGTAGTGTTCTTTG
TGTACGTTCTGCCTACTTCAGCCTTGCGTGTTACCGTTGCTAATGGTTGTTACTCAGCCTCACCATGGTATATTTCTCGG
GTGCACTACGCCAGGCACCAAGCGGCATCGACTACCAGAGCCGTGCCCGGGCGCGGTACAACGAGTCCAAGGTCGGCCTG
CTGATTGAGAACCGTTCTTTCCCGGTCCTGGCACCGCTTATGCTGCATTTCATCTCGGTGGTGCCACCCGACTGGCGGTT
CCGCTTCATGGGTTCGATCGAGTCGGTCAAGAAGATCAACGAGTCGGTCGCTATCCAGGAGCAAGTGCGGGCGGGCAAGC
TGGACCTGACATACATCCCGTCCAACATGACAACGGGAAGCCAGGAGGAGATCAGCCGCTTCCTAACGACGTTGTGGCTG
TACGAGACCGTGCTCCAGCCGGCGGAATGGCTGCTGCTCTTCCAGACGGACAGCATTCTGTGTGCCAACTCGCAGAGGAA
TTTGAACGACTACCTCGAGTATCACTGGATCGGTGCCCCTTGGACCAAGGACAGCCGCTGGGGCGGTAACGGCGGCCTGT
CTCTTCGCCGGGTGAGCGCCATGATCGACGTTCTGCGTGAGCAGGTTCGCATAGACGGCAGCGATCCGGAAGACGTCTGG
TTGGCTGAGCGTCTGGGTCACCGGCCGAAGTCCAAGGTGGCTAACGGCACTGTGTCGCTGACATTTTCGGGCGAGTCCTT
TGAGGGAGCCGAGACCAGGCTGGACAACTTTACGCTCTCCAACGCCAATTCCAGCGAGATCGCCGCTGCTGCCAAGGCTG
GCAAGCTGGTTGACGGCGTCGACAACTATCGTGTCGGCTTCTACGAGCCGATGGGCTACCACACCGGCGGCTCGGGCAAA
TATCTAAACGGTCATGTCTGGGGCACGCCCGAACAGCGGCGCCACATCTGGACCTACTGCCCAGAGGTCAAGATGACCCT
GGCCATGGACGCGGCCAAATTCGTGCCGGGCGAATGCGGTGCTGTTTGGAAGCGGACTGTCAACATCCCTGGCGCACATG
GCGTTGTGGATGTCGGCTACGGTACCGAAATCATCGATGACATACAGTATCCGGTGCTGCCCCCTGGTCTGTATCCATGG
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62