GenePrediction:GLEAN_5808 Details

Name: GLEAN_5808
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:819115..816900 (- strand)
Length: 2216
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:819115..818793 (- strand)
Length: 323
Type: CDS
Source: GLEAN
Position: GCSC_173:818730..816900 (- strand)
Length: 1831
>GLEAN_5808 class=GenePrediction position=GCSC_173:819115..816900 (- strand)
ATGTCGCAAGTCCTGTTCGCAGCAGCAGCAACTCCGAGCGGCGTCGGGTCCCAGGTGTTTGCCTGTCTGGCGCTCTTTGT
GCTCTCGCTCGTGGTGCTGCTAGTGCTGCGCTACTACCTGCCGCTCCGCACGACGCCGGCCTACCTGCTGGTGCCGGTGT
TTTTCGCCTTGTGGCTGCCGGCCAACATCATCCTTCTCGTGCCCATCGACCTTGCATCCAGCGCGCGGACCGATGACGAG
GCCACGCGGGGCATCTGGCTGCCTGAGTCGGTTCTGCGCGTTGCCTGGAGGATCACATACTGGCTGACGTTTGCCCTGAC
CTGGTAAGTCCAGTGTGTTTGCGTTCCCGGTGATCCGGCCTTGTGCTGACCGGCCTTCATCGCAGGACCATCCTTCCGAT
CCTGGCCGAGTACTCGGACGCGGGCTTTCGCGAGCCCAAGGACCGGCTCCTCTACTCGCTGCGCCAGAATGGTCAGTACC
ACCTGATGGTGTGTGGACTGGGGCTGGCCGGCCTCGTGTACGTGTTTGTCACGTCAGGCGCGTCGTTCATGGCGCTCAAG
AGCCTGGTCATGGCGCTGTCGTACTGCTGGGGCCTGGTGCTGGCCATCTACCTGATGGGTCACGGACTGGTAGCCATTCC
GCGGCGGCTGCTGCGGACGGCCACCCCGAGCCGCCGACTTCGACGGCTGCAGACCCAGGCGCCCAGCCTGTACGAGAAGT
TGGAGGAGGCCGAGATGGACCTGGAAGACATTGAGCTGCAGGTGTCGGAGCTGAGCCGGCGCAAGACGGGGTCGGCGCTG
GAGTTTCGCGACTGGATCGACGAGCTGGCCGAGACGGTTGGCCAGCCGGGTGCCCATCTACGGCCGAGCCTGGCGGCGTC
TGCACCGGCCGAAACCCGGACGATCCCGGCCGTGATCACGAAGAAGTACATGGCCGACGTGACGCGCCAGCTGGTGCGCA
GCCGCCATGCGCGGTCCCGCTACCAGAGCGAGTGGACGCGGCTGCTGCAGCGGTACGCGGAGACGCAGGTCGTGCTGAGC
TCGGTGACGTCACAGCGGCTTGACCGTGGCAGTGGCAACGGCAGCGTGTTGACGCCGTATACACGCTTCGTGTTGCACTA
TCACGTGATCCCGTACGTGCGAACAGCGTTGGGCGTGGTTCTGGCTCTGGCCTCGGCCGCCATCGTGTGGTCGGAGCTGG
TCAAGGCGGCCCTGCCGGCCGCCTCGGTGGTCAACCTGAGCGTGGTGCACCATTGGACCGGCGACAAGGGTCAGGTGGGC
TTTGCCGGCCAGCTGATCGCCGCCGGCTGGATCCTATACATGTGCACCGCCGCGCTGGCATCCGTTACCGAAGTTCGGGT
GTGGCGAGGCCGCGCGCTGGTCAGGCGCAACACAGCGCACGAGTCGGCATTTTGGTACGCGTCGCAGGTCGCTCGCCTGA
GCATCCCGCTGTCGTACAACTTTATGACCTTTGTGTCGCCCGGCGTGTACAAGAAGACGGTCTTTTACGACTTCCTCGGC
CGTCTGATCAACCTGACACCGTTGGGCGAATGGTTCGACTACGTCTTCCCGGCCTTTCTGCTACTGCCCGTCCTGGCCAC
CTTGCTGGGGCTCTACGGCAAGGTGCGGCGTGTCTGTGGCTTCGCCGACCGCCTGCCCGATGGCGACGACGACGGCAATG
GCGACAACACGCCGCACTACGGCACGGGATCCTGGCGTGAGGGTCGCGACCTGATCGAACGCGAGCTCGACGGCACGTCC
ATCCGGCAGCGGCGACAGGCAGCAGCAGGAGGAGGAGCTGCTGTTCGCAACAGTCGTCGGACCGGCGTCGACGAGGAAGC
CGGATCGACCACGACGCCATTTGCTGTCTCGCCGTCCAACTCGGGCTTCCTGCCACCTCGGACACGGACTCTGGGCAGCG
GCCAGCCGAGATCGCCAGCTGCTGACCGGTCCGCTCAGCAGAATACCGCCACCGCCGATGACGACAGCGACAGCGACGGC
AACTTCTTCCAGCTGCTGGGTCATCGCATGAAAAACACCATTGACACGATCGAGCCGCCTCGCTGGCTCCACGATCTCGG
CAACGGCATCAAAAAGCCCAGATGGATGGGTGGCGACGATGACACAGCATCGGCAGACGCTCCCGCAATTCGCCGTTGGT
TTGGTGGCTCGTCTGGAGACTCGTCTGGAGGCTCCGACGGCCACATTCGCCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62