GenePrediction:GLEAN_5811 Details

Name: GLEAN_5811
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:796681..795309 (- strand)
Length: 1373
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:796681..796415 (- strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_173:796352..796262 (- strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_173:796200..795820 (- strand)
Length: 381
Type: CDS
Source: GLEAN
Position: GCSC_173:795748..795309 (- strand)
Length: 440
>GLEAN_5811 class=GenePrediction position=GCSC_173:796681..795309 (- strand)
ATGGCCGACAAGAAGAACGAGGACTATGTTGTCCGCATGCCGGAGAGCGATGCGTTTTCGGAAAAGGGCTTCAGCAGCCG
GTCCAGCACGTATTCGTCGCGTGTCGGTCACGGCTCCGCCGCACCGCTGAACATCAACCAGCTGGACAACAGCCCGGGCC
TGTCCATCCTGGCGTATTGTTTGGCGTCCATCAGCATGACCGTGGTCAACAAATACGTCGTCTCTGGCAGCGCCTGGAAC
CTCAATTTCCTCTACCTTGCCATCCAGGTACGGCTTCCTCTTCGTGGCCATTGGCGACACAAACGCCCTGCTAACCATTG
CGTCCACAGTCCACGGTCTGCATACTGGCCATCCTGTTTGGCAAGCAGGTCGGCCTGATCAAGCACCTCTCTCCATTTGA
TCCGGAAAAGGGCAAACGATGTACGTTCTGACGACAAGACTTGCGGTGAACCGAAGAAGAAGGAGGCTGACCATACAACA
GGGTTCCCCATCTCGCTCCTGCTCGTCGGCATGATCTACACCGGTGCCAAGGCGCTGCAGTTCCTCTCGGTCCCCGTGTA
CACCATCTTCAAGAACCTGACGATCATTGTGATCGCGTACGGCGAGGTGCTCTGGTTCGGCGGCCAGGTGTCCCCGATCA
CGCTGCTCTCGTTCGGCCTGATGGTGCTGAGCTCCATCATCGCCGCCTGGGCCGACATCCAAGCCGCACTCAACAGCGTC
GGCCACACGGCCGCGGCCACCGAGGCTATCTCGACGCTGAACGCTGGCTACGCCTGGATGGGCCTGAACGTCTTCTGCTC
GGCCTCGTTTGTCCTGGGCATGCGCAAGGTGATCAAGAAGATGAACTTTAAGGACAAGGACAGTAGGTGCTTCCGACGGG
GATGGAGAAGCGAAACGCTCGCCGGACAGTCGCTAACCAAAACACCCACACAGCCATGTTCTACAACAACCTCCTCAGCA
TCCCGATCCTAGTGGTGTGCTCTCTCCTGCTCGAGGACTGGTCCAGCGAGAACCTGGAGCGCAACTTTCCTGTGGAGACG
CGGACGAAGCTGCTGATCGGCATGGTGTATTCGGGGCTGGCTGCTATCTTCATCTCGTACTGCTCGGCCTGGTGTGTGCG
CGTGACGTCGTCGACGACGTACTCGATGGTGGGCGCGCTGAACAAGCTGCCCATTGCCGTCAGCGGTCTCGTCTTCTTCG
ACGCCCCCATCACGTTTGGCAGCGTGGCGGCCATTGCGCTCGGCTTTGTCAGCGGCCTGGTGTACGCGTGGGCCAAGGTG
CGGCAGTCGGTCAAGCCGAGCGAGTCGCTGCCGATGCAGCAGCCGGTGATGAGCGCCAGCTCGCAGAGCAGCAAGGACGC
GTCGAACGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62