GenePrediction:GLEAN_5812 Details

Name: GLEAN_5812
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:794257..792158 (- strand)
Length: 2100
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:794257..794236 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_173:794172..794128 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_173:794053..793954 (- strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_173:793898..792158 (- strand)
Length: 1741
>GLEAN_5812 class=GenePrediction position=GCSC_173:794257..792158 (- strand)
ATGCTTCCCTACATCAACACGCGTGCGTTGCGGACGTCTGGGCTGTGTGTGTGTGTGTGTGCGTTTCGCTGACTGATCTG
TGCAGCGTTTGTGTACGCGAGCGAGCGGGTTGGAACGTCTCCCGATGAGCGTGAGTACGATCGAGTCAGCGAGAGCGGAT
GTTTCTATACCTTTCTCTGCTGACGGCTGTTGTTCTGGCCCCAGTCAAGATTATCTTCTCCTTTCTCCTGTCGTACCCGC
TCGCCGGCCTGCTGAAGAGGGTGCCTGATGCCCGTCCGGACGCCAAGAACCTGTTCATCATAGGGTAAGCTGCAGCTTCT
GTCTCGGTTGGTCCTGTCATATTATTCACACTTCTGCAGCGTGGCACTCTTCTATCTCGTCGGGCTCTTTGACCTGTGGG
ACGGCCTGCGCACGATTGCCATCTCGTCGGGCGCGGCCTATGGCATCGCGCACTTTCTCCGGGGCAGTCCATACATGCCC
TGGATTGGGTTCGTCTTCTTGATGGCCCACATGTCGGCCAACCAGCTGGCACGGCAGTCAACAGACGATCCGTCGACAGT
GGACATCACGGGGGCTCAGATGGTGCTGGTGATCAAGCTGAGCGCGTTCTGCTGGAACGTGGCCGACGGCGTGGTGGACG
ACGACCAGCTGACGCCCTTCCAGCGTGACCGGCTACTACGCGAGCTGCCGTCGCTGCTGGACTACGCCGGCTACGTGCTC
TTCTTCCCGTCACTGCTGATCGGTCCGGCCTGCGACTTTGCCGAGTACCGCCGCTGGCTCGACACGTCCATGTTTGCCGT
GCCGGCTTCGGTCGATCCGGCAAAGCGGCCGCGCACTCGACGACGACGCAAGATCCCGCGCAGTGCCACGCCGGCTATGA
TCAAGATGGCCACCGGTCTGGCCTGGATTGGCGCCCTTCTGGTGCTCAGCCCGCACTACAGCCCCGCGAATCTGCTGGCT
GGCGGCGAGGAGGCCGCGGCTGGCAGCCATGGCTTCATCGGCCGCATCGTCGAGTTTCTGCGTCGTGTCTGGACCCTCTA
TGCCGTCGGCTTCACCACCCGCACAAAGTACTACGGCGTCTGGTCACTGACCGAGGGTGCCTGCATCCTCGCCGGGCTCG
GCTTCAACGGCGTCGACCCGGTCTCGGGACGCATCTCGTGGAACCGCGTCCAGAACATCGATCCCTGGGGCGTCGAGTCC
GCCCAGAACACGCGTGCCTATCTGGAACACTGGAACATGAAGACCAACACATGGCTGCGCAACTACGTCTATCTGCGCGT
TACGCCGCGTGGCCGCAAGCCCGGCTTCCGTGCCAGCATGGCCACCTTTTTTACCAGCGCTCTCTGGCATGGCTTCTATC
CGGGCTACTATCTATCCTTTGTGTTGGCCAGCTTTATTCAGACGGTAGCCAAGAGTGCGTTTTTTTTTTTTCTTTTTTTT
CTTTTTTTTCTTTTTTTTCTTTTTTTTTCTTTTTTTTCTTTTTTTTCTTTTTCTCCTTCTTTTTCTATTCCCTTTCGTCT
TGCTGACTCCCACCCAGACTTCCGTCGATATCTGCGTCCCTTCTTTCTCGACCCCGTCACCCAGGCCCCGCTTCCCTCCA
AGACGGTCTACGACGTCCTCAGCTTCCTGGCTACCCAGATGGCCTTTAGCTTTGCCGTCGCGCCCTTTGTGCTGCTCAAC
TTGCAGGACTCGTTGCGCGCCTGGTCACGTGTCTCCTTCTTCGCCGTCATCGGCGTTGCTGTGTCCACGGCTGTGTTTGC
CTCGCCCGTCAAACCGGCGCTGAAGAAGCGGCTAGAGGCCCGAGCTGCTGCTGCTACTTCGGCTATGGCAAAGTCTGAGA
CGATTGCGCTTCCCGGCGGCGACACTGCTGCCAGTCTCAAGCCGCCGACATCGGCAGAGACCGACAAAATGACGATATCC
GCGTCCGCGTCGCCCGAACTGCCGCCCACAAAGCTGTTTGCCGTGCCGCCTAACGTCATGGGCTCTGGCCTGCCGGCCGA
CCCTGAGGGCGAGCTGGACGACATGGTGGCTGAGCTGCGCAGCGACATGGAGCTGCTGCAGAAGCGGGCGGCCGAGCTGG
CGGCCAAGAAGCGCTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62