GenePrediction:GLEAN_5813 Details

Name: GLEAN_5813
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:785319..784140 (- strand)
Length: 1180
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:785319..785271 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_173:785209..785166 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_173:785048..784140 (- strand)
Length: 909
>GLEAN_5813 class=GenePrediction position=GCSC_173:785319..784140 (- strand)
ATGCCTGCCATCCGGGGCTTCATTGACAAGTACATCTTTCACAAGGAGGGTAAGCTTTCATCCTCACCGAGTTTCTGGAT
TCGTGTCTCAGACTAACGGTACGTCTCCAGAAATCCCACCGCCCATCTCCACTGGAACGGCTGTGGCCCTGCTTGTGAGT
TGCCCCTGCGCCGTTTCATCTGATCTGTTCTGTCCGTTCTTCTTTCTACCTGTTTCCCGTTGTTTCGTCTTCTCCACTCG
TTCACTTCCATTCGTTCTCACTCCCCTCTAGGCCCTCTACACCGTCGCCTATGTTGCGCCCTTTTACCTCTCGTCCTTGA
CCAGGCCCTCGCCGACGCTCTCACGCGATGCCCCGTCGGTCATTCGGGCCCGCATCACCTCGGTGACGCTGACGTGCATC
GGCTGCTCGGCCGCCACGTTTGTGCTGCTGACGACGGCCGGCGCCACCGGCACCACACGTCTGCCGGCCACCGATGCACT
GCATCTCATGGGCTATCTGCCCGTGGGCTTGGGCGACGCGCTGCGAGCTCTGGCCTTGACGGCAGCCCTCTTTGCTGGGC
CGCTGCTGGAGCTGGTCCTGGTGGAGGTGCAGACGTGGCGGCTGCTACGATCGGACCGGTCGATGCTGACCTGCCTCGTG
GCCTCGCTCGCCGACAACCTCGCCGACTGGACCGTCTGGCGCAACATTGTCGCTGGCCCCGTCACCGAGGAGGTGCTCTT
CCGTGGCGCCGGTGTGCCGCCTCTGCTGCTCGCCCACACGTCGACAGCCTGCACGGTGCTGCTCTCGCCCGTCGTCTTCG
GGCTCGCCCACCTGCACCACGCTTACGAGTTCGCCGTGGTGCACCCGCGTGTTCCTCTCGCCGGTGTCGCCCTCCGCTCA
CTCGTCCAGTTCGCCTACACCACCCTCTTCGGCGTCTACGCCACCTTCCTCTTCCTCCGCACCGGCAGCTTGCTCGCCGC
CTGTCTCGTCCACAGCTTCTGCAACTGCATGGGTCTGCCGCGCTTCTGGGGCCGCCTCGAGCTGCCCCGCAACGACTCCG
ACTTCGAGACCGGCCGGCCCCGGAGCAACCTGCTCGCCACCCTGCTGTACTACGTCCTGCTCGTCGCCGGCGCCGCGTAT
TGGTACTGCCACCTGTGGACCCTGACGGCGAGCACGAATGCGCTGGTGTCGTTTGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62