GenePrediction:GLEAN_5814 Details

Name: GLEAN_5814
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:781605..778274 (- strand)
Length: 3332
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:781605..780343 (- strand)
Length: 1263
Type: CDS
Source: GLEAN
Position: GCSC_173:780282..779590 (- strand)
Length: 693
Type: CDS
Source: GLEAN
Position: GCSC_173:779485..779154 (- strand)
Length: 332
Type: CDS
Source: GLEAN
Position: GCSC_173:778986..778456 (- strand)
Length: 531
Type: CDS
Source: GLEAN
Position: GCSC_173:778379..778274 (- strand)
Length: 106
>GLEAN_5814 class=GenePrediction position=GCSC_173:781605..778274 (- strand)
ATGGATCTGTTCCAGGCGGTGTCGGGATACGTCACGCGGATGGTGACGGCAGGCGACAGCAGCGTGGGAACGGGCGGACT
GTCGTCGGGATCGTCACTGCCGTCGTCCGTGTCGGCCAAGATGAAGATTCTGTTGTTGGACCGCGAGACAGTGCCGATTG
TGTCGACGGCGGTGACGCAGTCGGCACTGCTCAACCACGAGGTGTATCTGATCGACCGGCTAGACAATGCGGGACGTGAA
AAGATGCGGCATCTGCGATGCTACTGCTTTGTGCGGCCGTCGGCAGAGGCGATCCAGCAGCTGGTGGAGGAGCTGCGGGA
CCCGCGATACGGCGAGTACAACCTCTTCTTTAGCAACGTGGTCAAGAAGTCGTCCATGGAGCGGCTGGCCGAGGCCGACG
ACCACGAAGTCGTCAAGCGCGTGCAGGAGTACTTTGCCGACTTTGTCGTCATCAACCCGGACCTGTTCTCGCTCGACTTC
AGCATCCGCGGCCGTATGGGCAGTGCCAAGAACAGCAATAGCCCCATCACGCACGTATGGGGGGCCAGCCCGGATGCGTG
GAACGCGGACGCGCTGCAGCGGTCGACCGAAGGCGTGCTGGCGGCACTGCTGGCGCTCAAGAAGAAGCCATTGATCCGGT
ATGCGCGCAGCAGCCTGCTGGCCAAGAAGCTGGCGACCGAGGTGCGATACCGCATCGCCCAGGAGGAGCAGCAGCTGTTC
GACTTCCGGCCCGTCGACACGCCGCCAATTCTGCTGATCGTCGACCGTCGCGAGGACCCGATCACGCCGCTACTAACCCA
GTGGACGTATCAGGCCATGGTGCACCAGATGTTCGGCATCCACAACGGGCGCGTGGATCTGCAGGCCGACGGCGACGGCA
ACGGCGACGGTGACAACAGCAACAACAACAACAGCAGCAGCGATCCGGCGTCGGGACTGCGCGAGACCGTGCTGTCGCAA
GACCAGGACCCGTTCTTCAAGCGGAACATGTTCCTCAACTTTGGCGACCTCGGGTCCAACGTGAAGGAGTACGTGGAGCA
ATTCCAGGCGCGGCACAAGAACAACGAGAACCTCGAGTCCATCTCGGACATGAAGCGCTTCGTCGAGGAGTACCCCGAGT
TCCGTAAGCTGTCGGGCAACGTGAGTAAGCACGTGCACCTGATCTCGGAGCTGAGTCGCCGCGTCAACGACGAGAACCTG
CTGGAGGTTAGCGAGTGCGAACAGAGCATAGTCTGCAACGACAACCACGCGGCAGACTTGAAGGTGAGCCAGCAGATGGG
TCCAAAAACCAGTTCCATTCTACAGGCAGCGCTGACAACCCAGACCATCCAGAAGCTGATCCAGAGCCCGACCGTGTCGT
CGGCCCACAAGGTCGGTCTGGTGGCGCTGTACGCGCTGCGCTACGAGAAGCAGCCGCAGAGCGGGACGACCGTGGCGATG
CTGGTCGAGCTGCTGACAGCGGCCGGTGGCGTGCCGTCGTGGCAGGCCGACCTGGTGGCCAAGCTGCTGGCCTACGAGCA
CTCGCTGCAGCACCGGAGCGGCGGGGGAGCCGGTGGCGACGACGGGGCTGGCGGTGGCGGCGGCATTGCCGAGATCTTTG
AGTCGAGCGGCATCTTTGGCGGCGGTGCCAAGGCGCTGCGCGGACTCAAAGGCGTCGACAACGTCTACACGATGCACTCG
CCCCTGCTCGAGACCACGCTGCACAGCCTCGTCAAGGGCCGCCTGCGCGAGCAGCAGTACCCCTTCGTCGACGGCGGCGG
CGCCACGCGCGACAAGCCGCAGGACATTATCGTATTTGCCATTGGCGGCACCACGTACGAGGAGGCCAAGGCCGTTGCCG
GACTCAACGCCTCGACACCGGGCGTGCGCATCGTGCTCGGCGGCACTACCGTCCACAATGCCACCAGCTTCTGGGACGAG
ATCGACAGCGCCGTGTCGTCGTGGCCGGAGCCGCCACCCAACACGACCGCCGGTCGGCTGCGCAAGGAGCTTGGGAGGAG
GTGGAAGGAGGGGGGGGTTGATGTGTATTACATAATGATGAGTCAGCAATGAAAATGAATCGGTTTTCCCTAGGCTGCCC
AGTCAGCAGCGACGTATTCTGACCTCGGACAAAAAAACAGAGAAAACACGACCGACGCAAACAGGCCCCCGGAACACGGG
CTCAACTCACCCGCGCCGACCCCCTGGATGGCCATGTGTCGCCGCAGCGCCTGGCCACAATGCTGAGACTGACTAGGAGG
ACGACGAGGGCGGCGACGGAGACCAATGGCTGTGGTTGGGGCCGCAGCCAGACAGCAGCTGCCGTATCGACGTCAGCAGC
CATGCCACAGCTGCCACGATCGTGGATCCTGGCACGGCGACGACAGGACGCTGCACGGCCGGTGCTGCTGTCAGCAGCCG
CTGTCTGGAGGCGACCAGGCAGTCTGACACGCAGCTTGTCGGACAATTCGAGGTGTGTTTGGTCGTCTCGTTCTGGAGTC
TCTTTGCTCTCTTGCTTCCTTTTTTTTCTCTTCTCTCTCTCTTCTCTCTCTCTTCTCTTTCTTCTCTTCCCTTTCTCTTC
TCTTTCTTCTCTTCCCTTTCTTCTCTTCTCAGCTTTCATGCCTCATGCTAACCTCCCAGCCCATCCCGTCGCGAAAACAT
CTACACGGTCCCCAACATGCTGACGGTGGCCCGTCTGGCAGCCGCCCCGTTTGTCGGCTACTGCATCCTGCACGACATGC
CCGGCACGGCTCTGGGACTTCTCGCTGCTGCTGGCGTGTCCGACCTGCTCGACGGCTGGATCGCACGGCGCTGGCAGCTG
CGTACTGTCGTCGGCAGCATCATCGACCCCATGGCCGACAAGGTGCTCATGACCGTTCTGGCCGTCAGCCTCGCCGCTGA
GGGTGGCCTCCCGCTCTGGCTGGCTGCTCTTATTCTTGGCCGTGACGCCGGCCTCGCTATCGCTGCCGTCTACTACCGCT
GGGTCTCCCTGCCGCCACCCAAAACCCTCGCCCGCTACTGGGATTTCTCCCTGCCGTCTGCCGAGGTCCGCCCGACTACC
ATCAGCAAGTATAACACCTTCTTGCAGCTCGCTCTCATGGCTACCACCACCGCCGCGCCCGTCGCCGCCTCGGCCGGCCT
CGATCTTGCTACCGGCCTGACCGCAATGCAGTACGTGCTGTTTTTCTGACATGTGCCAAGTCACGTGTTTTCGCATGTTC
TTATTTCCCGCTGACAAATCACCCAGATATGTCGTCGCCGGCACCACCGTCTGGAGCGGCCTGAGCTACGTCTACAGCAA
GGATGCGGTCAAGATCCTGTCGCAGGACCGGACGGGGTCCAAGTCCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62